ID: 1170543476

View in Genome Browser
Species Human (GRCh38)
Location 20:17412014-17412036
Sequence GATGTTGGTGATCTACAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7417
Summary {0: 1, 1: 39, 2: 501, 3: 3966, 4: 2910}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170543476_1170543482 11 Left 1170543476 20:17412014-17412036 CCCATTTGTAGATCACCAACATC 0: 1
1: 39
2: 501
3: 3966
4: 2910
Right 1170543482 20:17412048-17412070 GTAGATAAAACCACAAATATGGG 0: 28
1: 5357
2: 1923
3: 583
4: 577
1170543476_1170543483 12 Left 1170543476 20:17412014-17412036 CCCATTTGTAGATCACCAACATC 0: 1
1: 39
2: 501
3: 3966
4: 2910
Right 1170543483 20:17412049-17412071 TAGATAAAACCACAAATATGGGG 0: 26
1: 5239
2: 2051
3: 963
4: 1263
1170543476_1170543481 10 Left 1170543476 20:17412014-17412036 CCCATTTGTAGATCACCAACATC 0: 1
1: 39
2: 501
3: 3966
4: 2910
Right 1170543481 20:17412047-17412069 GGTAGATAAAACCACAAATATGG 0: 22
1: 2437
2: 4248
3: 1093
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170543476 Original CRISPR GATGTTGGTGATCTACAAAT GGG (reversed) Intronic
Too many off-targets to display for this crispr