ID: 1170545116

View in Genome Browser
Species Human (GRCh38)
Location 20:17429386-17429408
Sequence GATATGCAGTGAAACGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545116_1170545117 9 Left 1170545116 20:17429386-17429408 CCAAATTCGTTTCACTGCATATC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1170545117 20:17429418-17429440 TTTATATTTTTCCAAAGCCACGG 0: 1
1: 0
2: 4
3: 99
4: 1190
1170545116_1170545118 10 Left 1170545116 20:17429386-17429408 CCAAATTCGTTTCACTGCATATC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1170545118 20:17429419-17429441 TTATATTTTTCCAAAGCCACGGG 0: 1
1: 0
2: 1
3: 35
4: 473
1170545116_1170545120 24 Left 1170545116 20:17429386-17429408 CCAAATTCGTTTCACTGCATATC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1170545120 20:17429433-17429455 AGCCACGGGACCCGATGTGCAGG 0: 1
1: 0
2: 2
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545116 Original CRISPR GATATGCAGTGAAACGAATT TGG (reversed) Intronic
901766654 1:11504078-11504100 GATAAGCAGTGGAAGGAATGAGG - Intronic
902035074 1:13452048-13452070 GATATGAAGTGAATCAAATTTGG - Intergenic
903091870 1:20927551-20927573 GAAATGGAGTGAAAAGAAATGGG + Intronic
908748956 1:67401346-67401368 GATATGTAGTGCAAGGAATGGGG - Intergenic
918999111 1:191805227-191805249 GATTTGCAGTTAAACTAAATTGG - Intergenic
920444609 1:206006454-206006476 AATATGCAGAGAAACGATGTGGG + Intergenic
921659689 1:217786663-217786685 TAGATGCAGTGAAACCCATTAGG + Intronic
922183030 1:223250972-223250994 CATGTGCAGTGGATCGAATTGGG + Intronic
924385613 1:243496172-243496194 GAAATGAAGTGAATGGAATTGGG + Intronic
1065435990 10:25704376-25704398 GATATGGAGTGAAAGAAAGTGGG - Intergenic
1079902931 11:26210182-26210204 CATATGCAGAGAAATGAAATTGG - Intergenic
1087893375 11:103560532-103560554 GAAATGAAGAGAAAAGAATTGGG + Intergenic
1091206140 11:133822693-133822715 GATATGCAGTGACTCAAAGTTGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1098575376 12:72035957-72035979 TAGAAGCAGTGAAACCAATTAGG + Intronic
1102370502 12:112379216-112379238 GATGTGCAGTGAACAGAACTAGG + Intronic
1108028002 13:46198922-46198944 CAGATGCAGTGAGACAAATTGGG + Intronic
1109458227 13:62622154-62622176 CATATGCAGAGAAAGAAATTGGG + Intergenic
1110826595 13:79978153-79978175 GATATTCATTGAAACCAATGAGG + Intergenic
1112782182 13:102913055-102913077 GATAAGCAGGGAACCGAAATGGG - Intergenic
1113001642 13:105645575-105645597 TATATAAAGTGAAAGGAATTTGG - Intergenic
1114074753 14:19153154-19153176 GATATGCATGTAAGCGAATTTGG - Intergenic
1114087514 14:19246821-19246843 GATATGCATGTAAGCGAATTTGG + Intergenic
1115538849 14:34400008-34400030 GATATGCAGTGGCACGATCTTGG - Intronic
1116209853 14:41922562-41922584 GAAATTCAGTTAAAAGAATTTGG + Intergenic
1116227659 14:42172267-42172289 GATATGCAGTGAACATATTTTGG + Intergenic
1117443400 14:55780601-55780623 GACCTGCAGTGGAAGGAATTTGG + Intergenic
1118106579 14:62666616-62666638 GAGATGCTGTCAAATGAATTGGG + Intergenic
1120674468 14:87404904-87404926 CATTTGCAGTGAATTGAATTGGG + Intergenic
1126534819 15:49749958-49749980 GCAATGAAGTGAAATGAATTTGG + Intergenic
1129736688 15:77970404-77970426 GAGATGCAGAGACACTAATTGGG + Intergenic
1129911239 15:79228395-79228417 GACATGCAGTGAAAAGAACTCGG + Intergenic
1130252910 15:82312518-82312540 GAGATGCAGAGACACTAATTGGG + Intergenic
1135121495 16:19770107-19770129 GATATGAAGAGAAACGGTTTGGG + Intronic
1135618407 16:23931870-23931892 GAAATGGAGTGAAAAGCATTGGG - Intronic
1138139321 16:54553900-54553922 GATAGCCAACGAAACGAATTAGG - Intergenic
1141859836 16:86708960-86708982 GAATTGCAGTCAACCGAATTGGG - Intergenic
1148188549 17:45662222-45662244 GCTTTGCAGTCAGACGAATTTGG + Intergenic
1168037444 19:53731311-53731333 GATATGCAGTGAGGCGATCTCGG + Intergenic
930553661 2:52868705-52868727 GATATGGAGTCAAAAGAATAGGG - Intergenic
941986161 2:171513900-171513922 GATATGCAGACCAACCAATTAGG + Intergenic
942225483 2:173811338-173811360 GACATGAAGTGGAAAGAATTTGG - Intergenic
944252959 2:197596056-197596078 AATTTGCAGTGAAGGGAATTTGG - Exonic
947981153 2:234410764-234410786 GCTATGCAGAGAAGCGAATGAGG - Intergenic
948228552 2:236332915-236332937 GATCTGCAGTGAAACCAAGGAGG + Intronic
1170545116 20:17429386-17429408 GATATGCAGTGAAACGAATTTGG - Intronic
1172561289 20:35890829-35890851 GAAATGCAGTGGAACGATCTCGG - Intronic
1173077860 20:39837531-39837553 GATATGCCCTTAAACAAATTTGG - Intergenic
1173400807 20:42724336-42724358 GAGATGCAGTGAATAGATTTGGG - Intronic
1180290399 22:10846088-10846110 GATATGCATGTAAGCGAATTTGG - Intergenic
1180493198 22:15875509-15875531 GATATGCATGTAAGCGAATTTGG - Intergenic
952888485 3:38025852-38025874 GAGCTGCAGTGAAGCGAACTGGG - Intronic
953773273 3:45795214-45795236 AATATGCAGAGAAAAGAATGGGG - Intronic
954098138 3:48347468-48347490 GAAATGCTGTGAAACAAACTCGG + Intergenic
956677595 3:71750812-71750834 GAAGTGCAGTGACACGATTTCGG + Intronic
957613863 3:82504482-82504504 AAGATGCATTGAAAAGAATTTGG - Intergenic
959931135 3:111984260-111984282 GGTTTGAAGTGAAACGATTTTGG - Intronic
964169117 3:153746407-153746429 GATATGAACTGAAACAACTTAGG + Intergenic
974825255 4:67120088-67120110 GAAATGTAGTCATACGAATTGGG + Intergenic
976311598 4:83618824-83618846 GATAGGCAGAGAAATGACTTTGG + Intergenic
976440845 4:85072499-85072521 GATATGTACTGAGACAAATTTGG - Intergenic
980181292 4:129404471-129404493 GTTAAGCAGAGAAAAGAATTTGG + Intergenic
981143635 4:141300299-141300321 GCTATGTAGTGATAAGAATTTGG - Intergenic
983098048 4:163588633-163588655 AATATTCAGTGAACAGAATTGGG - Intronic
984136985 4:175953400-175953422 GATATGTAGTACAAAGAATTAGG + Intronic
989329864 5:40244179-40244201 GATATGCAGTCAGACACATTTGG + Intergenic
996267982 5:121565546-121565568 GATACTTAGTGAAATGAATTTGG - Intergenic
996487807 5:124057362-124057384 TCTATCCAGTGAAAGGAATTTGG - Intergenic
1000946821 5:167432468-167432490 GAGATGAAGAGAAACAAATTGGG - Intronic
1008428504 6:51387452-51387474 CATATGCTGTGAAACATATTTGG + Intergenic
1014789985 6:125661546-125661568 GATGTGCAGTGAAACCAAGGAGG - Intergenic
1015764192 6:136698836-136698858 AGTATGCAGTGAAAGGAATTGGG - Intronic
1017918313 6:158850196-158850218 AATAGGCAATGAAACGAATCTGG + Intergenic
1027143913 7:75680824-75680846 GGAGTGCAGTGACACGAATTCGG + Intronic
1027607238 7:80315408-80315430 GGTGTGCAGTGAGACGAGTTTGG + Intergenic
1031231964 7:119119045-119119067 GCTATGTAGTGAAACTAATGAGG - Intergenic
1031809795 7:126352208-126352230 TATATGCAAGGAAATGAATTAGG + Intergenic
1034332445 7:150294505-150294527 GATCTGTAGTTAAATGAATTTGG + Intronic
1036180903 8:6584482-6584504 TATATGCAGCTAAAAGAATTGGG - Intronic
1037221758 8:16531638-16531660 AAAATGAAGTGAAACAAATTAGG - Intronic
1039321210 8:36434057-36434079 TATATGTAGTGAATTGAATTTGG + Intergenic
1041764419 8:61403439-61403461 GAGATGCAGGGAAACCAGTTAGG + Intronic
1044102361 8:88156432-88156454 GATATGCAGTCAACAGACTTAGG + Intronic
1045435982 8:102164833-102164855 GACATTCAGTGAATGGAATTAGG + Intergenic
1045603848 8:103750127-103750149 AATATGCAGTGAATCCAGTTGGG - Intronic
1046040600 8:108899128-108899150 TATATGCAGATAAATGAATTTGG + Intergenic
1047455865 8:125010567-125010589 GAAATGAAGTGAAATGAAGTGGG + Intronic
1052724997 9:32218206-32218228 GACTTGTAGTGAAAAGAATTTGG - Intergenic
1060632405 9:125171602-125171624 GAAATGCAGTGACACGATCTCGG + Intronic
1202608385 Y:26658361-26658383 GATATGAAGTGAATTGATTTGGG + Intergenic