ID: 1170545912

View in Genome Browser
Species Human (GRCh38)
Location 20:17435843-17435865
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545912_1170545927 19 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545927 20:17435885-17435907 GATGGCCAAACGGGGACCGGAGG No data
1170545912_1170545926 16 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545912_1170545922 9 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545922 20:17435875-17435897 GGCCTTTGTGGATGGCCAAACGG No data
1170545912_1170545921 1 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545921 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
1170545912_1170545916 -3 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545916 20:17435863-17435885 TCCCCCTGGAGAGGCCTTTGTGG No data
1170545912_1170545923 10 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545923 20:17435876-17435898 GCCTTTGTGGATGGCCAAACGGG No data
1170545912_1170545925 11 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545925 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
1170545912_1170545929 25 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545929 20:17435891-17435913 CAAACGGGGACCGGAGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545912 Original CRISPR GGATCTCAGTAGCCGCCATT GGG (reversed) Intronic