ID: 1170545913

View in Genome Browser
Species Human (GRCh38)
Location 20:17435844-17435866
Sequence GGGATCTCAGTAGCCGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545913_1170545926 15 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545913_1170545921 0 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545921 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
1170545913_1170545929 24 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545929 20:17435891-17435913 CAAACGGGGACCGGAGGCCTAGG No data
1170545913_1170545916 -4 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545916 20:17435863-17435885 TCCCCCTGGAGAGGCCTTTGTGG No data
1170545913_1170545927 18 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545927 20:17435885-17435907 GATGGCCAAACGGGGACCGGAGG No data
1170545913_1170545923 9 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545923 20:17435876-17435898 GCCTTTGTGGATGGCCAAACGGG No data
1170545913_1170545922 8 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545922 20:17435875-17435897 GGCCTTTGTGGATGGCCAAACGG No data
1170545913_1170545925 10 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545925 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545913 Original CRISPR GGGATCTCAGTAGCCGCCAT TGG (reversed) Intronic