ID: 1170545915

View in Genome Browser
Species Human (GRCh38)
Location 20:17435854-17435876
Sequence CTACTGAGATCCCCCTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545911_1170545915 -8 Left 1170545911 20:17435839-17435861 CCAACCCAATGGCGGCTACTGAG No data
Right 1170545915 20:17435854-17435876 CTACTGAGATCCCCCTGGAGAGG No data
1170545910_1170545915 -7 Left 1170545910 20:17435838-17435860 CCCAACCCAATGGCGGCTACTGA No data
Right 1170545915 20:17435854-17435876 CTACTGAGATCCCCCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545915 Original CRISPR CTACTGAGATCCCCCTGGAG AGG Intronic