ID: 1170545916

View in Genome Browser
Species Human (GRCh38)
Location 20:17435863-17435885
Sequence TCCCCCTGGAGAGGCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545910_1170545916 2 Left 1170545910 20:17435838-17435860 CCCAACCCAATGGCGGCTACTGA No data
Right 1170545916 20:17435863-17435885 TCCCCCTGGAGAGGCCTTTGTGG No data
1170545913_1170545916 -4 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545916 20:17435863-17435885 TCCCCCTGGAGAGGCCTTTGTGG No data
1170545911_1170545916 1 Left 1170545911 20:17435839-17435861 CCAACCCAATGGCGGCTACTGAG No data
Right 1170545916 20:17435863-17435885 TCCCCCTGGAGAGGCCTTTGTGG No data
1170545912_1170545916 -3 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545916 20:17435863-17435885 TCCCCCTGGAGAGGCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545916 Original CRISPR TCCCCCTGGAGAGGCCTTTG TGG Intronic