ID: 1170545917

View in Genome Browser
Species Human (GRCh38)
Location 20:17435864-17435886
Sequence TCCACAAAGGCCTCTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 237}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545917_1170545929 4 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545929 20:17435891-17435913 CAAACGGGGACCGGAGGCCTAGG No data
1170545917_1170545931 20 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545917_1170545925 -10 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545925 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
1170545917_1170545926 -5 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545917_1170545935 23 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545935 20:17435910-17435932 TAGGAGCACCAGCTCTGCGGGGG No data
1170545917_1170545933 21 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545933 20:17435908-17435930 CCTAGGAGCACCAGCTCTGCGGG No data
1170545917_1170545934 22 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545934 20:17435909-17435931 CTAGGAGCACCAGCTCTGCGGGG No data
1170545917_1170545927 -2 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545927 20:17435885-17435907 GATGGCCAAACGGGGACCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545917 Original CRISPR TCCACAAAGGCCTCTCCAGG GGG (reversed) Intronic