ID: 1170545919

View in Genome Browser
Species Human (GRCh38)
Location 20:17435866-17435888
Sequence CATCCACAAAGGCCTCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545919_1170545929 2 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1170545929 20:17435891-17435913 CAAACGGGGACCGGAGGCCTAGG No data
1170545919_1170545935 21 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1170545935 20:17435910-17435932 TAGGAGCACCAGCTCTGCGGGGG No data
1170545919_1170545931 18 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545919_1170545927 -4 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1170545927 20:17435885-17435907 GATGGCCAAACGGGGACCGGAGG No data
1170545919_1170545933 19 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1170545933 20:17435908-17435930 CCTAGGAGCACCAGCTCTGCGGG No data
1170545919_1170545934 20 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1170545934 20:17435909-17435931 CTAGGAGCACCAGCTCTGCGGGG No data
1170545919_1170545926 -7 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545919 Original CRISPR CATCCACAAAGGCCTCTCCA GGG (reversed) Intronic