ID: 1170545920

View in Genome Browser
Species Human (GRCh38)
Location 20:17435867-17435889
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545920_1170545927 -5 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545927 20:17435885-17435907 GATGGCCAAACGGGGACCGGAGG No data
1170545920_1170545933 18 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545933 20:17435908-17435930 CCTAGGAGCACCAGCTCTGCGGG No data
1170545920_1170545935 20 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545935 20:17435910-17435932 TAGGAGCACCAGCTCTGCGGGGG No data
1170545920_1170545926 -8 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545920_1170545931 17 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545920_1170545929 1 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545929 20:17435891-17435913 CAAACGGGGACCGGAGGCCTAGG No data
1170545920_1170545934 19 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545934 20:17435909-17435931 CTAGGAGCACCAGCTCTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545920 Original CRISPR CCATCCACAAAGGCCTCTCC AGG (reversed) Intronic