ID: 1170545924

View in Genome Browser
Species Human (GRCh38)
Location 20:17435877-17435899
Sequence CCCCGTTTGGCCATCCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545924_1170545934 9 Left 1170545924 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
Right 1170545934 20:17435909-17435931 CTAGGAGCACCAGCTCTGCGGGG No data
1170545924_1170545931 7 Left 1170545924 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545924_1170545935 10 Left 1170545924 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
Right 1170545935 20:17435910-17435932 TAGGAGCACCAGCTCTGCGGGGG No data
1170545924_1170545933 8 Left 1170545924 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
Right 1170545933 20:17435908-17435930 CCTAGGAGCACCAGCTCTGCGGG No data
1170545924_1170545929 -9 Left 1170545924 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
Right 1170545929 20:17435891-17435913 CAAACGGGGACCGGAGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545924 Original CRISPR CCCCGTTTGGCCATCCACAA AGG (reversed) Intronic