ID: 1170545925

View in Genome Browser
Species Human (GRCh38)
Location 20:17435877-17435899
Sequence CCTTTGTGGATGGCCAAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545910_1170545925 16 Left 1170545910 20:17435838-17435860 CCCAACCCAATGGCGGCTACTGA No data
Right 1170545925 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
1170545912_1170545925 11 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545925 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
1170545911_1170545925 15 Left 1170545911 20:17435839-17435861 CCAACCCAATGGCGGCTACTGAG No data
Right 1170545925 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
1170545917_1170545925 -10 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545925 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
1170545913_1170545925 10 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545925 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545925 Original CRISPR CCTTTGTGGATGGCCAAACG GGG Intronic