ID: 1170545926

View in Genome Browser
Species Human (GRCh38)
Location 20:17435882-17435904
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545910_1170545926 21 Left 1170545910 20:17435838-17435860 CCCAACCCAATGGCGGCTACTGA No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545918_1170545926 -6 Left 1170545918 20:17435865-17435887 CCCCTGGAGAGGCCTTTGTGGAT No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545912_1170545926 16 Left 1170545912 20:17435843-17435865 CCCAATGGCGGCTACTGAGATCC No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545919_1170545926 -7 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545917_1170545926 -5 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545913_1170545926 15 Left 1170545913 20:17435844-17435866 CCAATGGCGGCTACTGAGATCCC No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545911_1170545926 20 Left 1170545911 20:17435839-17435861 CCAACCCAATGGCGGCTACTGAG No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data
1170545920_1170545926 -8 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545926 20:17435882-17435904 GTGGATGGCCAAACGGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type