ID: 1170545928

View in Genome Browser
Species Human (GRCh38)
Location 20:17435890-17435912
Sequence CTAGGCCTCCGGTCCCCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545928_1170545931 -6 Left 1170545928 20:17435890-17435912 CCAAACGGGGACCGGAGGCCTAG No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545928_1170545935 -3 Left 1170545928 20:17435890-17435912 CCAAACGGGGACCGGAGGCCTAG No data
Right 1170545935 20:17435910-17435932 TAGGAGCACCAGCTCTGCGGGGG No data
1170545928_1170545934 -4 Left 1170545928 20:17435890-17435912 CCAAACGGGGACCGGAGGCCTAG No data
Right 1170545934 20:17435909-17435931 CTAGGAGCACCAGCTCTGCGGGG No data
1170545928_1170545933 -5 Left 1170545928 20:17435890-17435912 CCAAACGGGGACCGGAGGCCTAG No data
Right 1170545933 20:17435908-17435930 CCTAGGAGCACCAGCTCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170545928 Original CRISPR CTAGGCCTCCGGTCCCCGTT TGG (reversed) Intronic