ID: 1170545931

View in Genome Browser
Species Human (GRCh38)
Location 20:17435907-17435929
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170545917_1170545931 20 Left 1170545917 20:17435864-17435886 CCCCCTGGAGAGGCCTTTGTGGA No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545924_1170545931 7 Left 1170545924 20:17435877-17435899 CCTTTGTGGATGGCCAAACGGGG No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545920_1170545931 17 Left 1170545920 20:17435867-17435889 CCTGGAGAGGCCTTTGTGGATGG No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545919_1170545931 18 Left 1170545919 20:17435866-17435888 CCCTGGAGAGGCCTTTGTGGATG No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545928_1170545931 -6 Left 1170545928 20:17435890-17435912 CCAAACGGGGACCGGAGGCCTAG No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data
1170545918_1170545931 19 Left 1170545918 20:17435865-17435887 CCCCTGGAGAGGCCTTTGTGGAT No data
Right 1170545931 20:17435907-17435929 GCCTAGGAGCACCAGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type