ID: 1170546306

View in Genome Browser
Species Human (GRCh38)
Location 20:17437994-17438016
Sequence GTCCTCTGGGAGCACGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170546306_1170546312 1 Left 1170546306 20:17437994-17438016 CCCACACCGTGCTCCCAGAGGAC 0: 1
1: 0
2: 1
3: 2
4: 142
Right 1170546312 20:17438018-17438040 CTCTGTAATCAGCCTGGACGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1170546306_1170546313 2 Left 1170546306 20:17437994-17438016 CCCACACCGTGCTCCCAGAGGAC 0: 1
1: 0
2: 1
3: 2
4: 142
Right 1170546313 20:17438019-17438041 TCTGTAATCAGCCTGGACGTGGG 0: 1
1: 0
2: 0
3: 8
4: 69
1170546306_1170546315 17 Left 1170546306 20:17437994-17438016 CCCACACCGTGCTCCCAGAGGAC 0: 1
1: 0
2: 1
3: 2
4: 142
Right 1170546315 20:17438034-17438056 GACGTGGGACTCACACCACAAGG 0: 1
1: 0
2: 0
3: 8
4: 124
1170546306_1170546311 -5 Left 1170546306 20:17437994-17438016 CCCACACCGTGCTCCCAGAGGAC 0: 1
1: 0
2: 1
3: 2
4: 142
Right 1170546311 20:17438012-17438034 AGGACTCTCTGTAATCAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170546306 Original CRISPR GTCCTCTGGGAGCACGGTGT GGG (reversed) Intronic
900504070 1:3020487-3020509 GTCCTCTGGGAGAACTCTGGGGG + Intergenic
901273899 1:7975374-7975396 GGCCTCTGGAAGCAAGGTCTTGG + Intronic
902970840 1:20047414-20047436 CTCCTCTGTGAGCACTCTGTAGG + Intronic
904963448 1:34352759-34352781 CTCTTCTGGGAGCAAGGAGTGGG + Intergenic
905518772 1:38581507-38581529 GTCCTGTGGGAACCTGGTGTGGG - Intergenic
907021616 1:51072036-51072058 GACCGCTGGGAGCACAGTGGAGG + Intergenic
907450104 1:54540962-54540984 ATCCTCTGAGAGCACGGTAAGGG - Intergenic
912951987 1:114126585-114126607 ATGCTCTGGGAGCAAGGTGGGGG + Intronic
915215436 1:154337396-154337418 GCCATCTGGGAGCACGAGGTGGG + Exonic
915366805 1:155321337-155321359 TTCCTCTGGGAGTAAGGGGTAGG + Intronic
915601378 1:156924852-156924874 CACCGCTGGGAGAACGGTGTGGG + Intronic
918343840 1:183589574-183589596 GTCTGCTGGGGGCATGGTGTGGG - Intronic
918504635 1:185238376-185238398 GTGCTTTGAGAGCAAGGTGTTGG + Intronic
920652274 1:207847438-207847460 GTGCTCTGGGAGGTCGGGGTGGG + Intergenic
922966054 1:229691846-229691868 GTCCTGTGGGAGCACAGAGCAGG + Intergenic
923275840 1:232395521-232395543 GTACTATGGGAGCACGTAGTTGG + Intergenic
1063982471 10:11465641-11465663 TTCCGCTGCCAGCACGGTGTGGG - Intronic
1064252064 10:13713667-13713689 GTCCTCTGAGAGCACAGGTTTGG - Intronic
1065111571 10:22445112-22445134 GTGCTGTGAGAGCACGGTGATGG + Intronic
1070025670 10:72629153-72629175 GTACTTTGGGAGGACGATGTGGG - Intergenic
1071478159 10:86042376-86042398 AGCCTCTGGGTGCACAGTGTGGG + Intronic
1076161698 10:128248518-128248540 GTCATCTGGGAGCAGGATTTTGG + Intergenic
1077483305 11:2826644-2826666 TCCCTCTGGGAGCACAGTGGTGG - Intronic
1078171435 11:8931951-8931973 GGGCTCTGGGAGCACAATGTAGG + Intronic
1079313427 11:19387240-19387262 GTGCTCAGGGAGCATGGTGGCGG + Intronic
1080818958 11:35787104-35787126 GACCTCTGGGAAAGCGGTGTGGG + Intronic
1081806225 11:45892247-45892269 GTCCTCTGGGAAGACGGTGCTGG - Intronic
1083350611 11:62026018-62026040 GTCCTCCGTGAGCAAGGTGGGGG - Intergenic
1085384344 11:76148569-76148591 GTCCCCTGGGAGCTCTGTGAAGG + Intergenic
1085403108 11:76246271-76246293 GTCCTCAGGGAGCTCGGTGAAGG - Intergenic
1088010954 11:105000426-105000448 GTCCTCTGACAGCACGTTCTTGG - Exonic
1089315809 11:117590549-117590571 GACCCCTGGAAGGACGGTGTGGG - Intronic
1094116518 12:26920259-26920281 GTGCTGTGGGAGCACGGAGGAGG - Intronic
1102592063 12:113963992-113964014 GTGCTGTGGGAGCACAGTGAGGG - Intronic
1104146672 12:126040657-126040679 GTCCTCTAGGACCACAGTGATGG - Intergenic
1105545590 13:21348354-21348376 GTCCTCTGGGGTAAGGGTGTTGG - Intergenic
1105685618 13:22778118-22778140 TTCCTCTGGGACCATGATGTGGG + Intergenic
1106908726 13:34439495-34439517 GTACTCTGGGAACTCGGGGTGGG - Intergenic
1114738152 14:25064232-25064254 GTCCTCTGGGAACAACGTGGTGG + Intergenic
1118884285 14:69853569-69853591 TTCCTCTGGAGGCAGGGTGTGGG + Intergenic
1120496896 14:85249099-85249121 GTACACTGGAAGCACAGTGTGGG + Intergenic
1130433618 15:83874272-83874294 TTCCTCTGGGAGCTCTGCGTGGG - Intronic
1132607692 16:800397-800419 GTCCACGGGGTGCACGGGGTGGG - Intronic
1133898185 16:9949103-9949125 GTGTTCTGGGAGCACCGTGGAGG - Intronic
1135407340 16:22207366-22207388 GACCTCTGGGACCTCGGTGGTGG + Intronic
1136064507 16:27749704-27749726 GTCCCCCGGGAGCTCCGTGTTGG - Exonic
1137603841 16:49774288-49774310 GTCCTCTGGGGGCCCTGGGTGGG - Intronic
1138498355 16:57422807-57422829 GTCCTCTGGGAGGACAGCGAAGG + Intergenic
1141924215 16:87156655-87156677 GTCCTATGGCAGCTCTGTGTGGG - Intronic
1142007294 16:87695559-87695581 GTCCTCTGGAAGCAGACTGTGGG + Intronic
1143532378 17:7512866-7512888 GACCCCGGGGAGCCCGGTGTGGG - Exonic
1143720749 17:8807441-8807463 GTCCTATGGGAGCACAGAGGTGG + Intronic
1147150500 17:38511062-38511084 GGCCCCTGGGTGCATGGTGTGGG + Exonic
1148106309 17:45120776-45120798 GTCCTGAGGGCGCACGGTCTGGG - Intronic
1151746584 17:76014881-76014903 GTCCTCGGGGCACAGGGTGTGGG - Intronic
1151974341 17:77475932-77475954 GTGCTCTGAGAGCCAGGTGTGGG + Intronic
1152897470 17:82921015-82921037 GTGCTCTGGCAGCCCAGTGTGGG - Intronic
1161350162 19:3786647-3786669 GTCCTCTGGGAGTCCGGGCTTGG - Intronic
1163462644 19:17448277-17448299 GTCCTCTGGCAGCCCGGGGCCGG + Exonic
1164699899 19:30277898-30277920 GCCCTCTGGGAGGAGGGTGGTGG + Intronic
1166373266 19:42313891-42313913 GGTCTTTGGGAGCACGGGGTGGG + Intronic
1166795474 19:45423182-45423204 GGCCTGTGGGACCAGGGTGTGGG - Intronic
1167052706 19:47089530-47089552 GTCCTTTGGGAGGAAGGTGGAGG - Intronic
925132465 2:1503525-1503547 GTCCTCTGAGAGCAAGGACTGGG - Intronic
925601479 2:5612447-5612469 GACGTCTGGGATGACGGTGTTGG - Intergenic
927209793 2:20632066-20632088 GTCCTCTGTGAGCAGGAAGTGGG - Intronic
928123298 2:28599298-28599320 GGCCTCTAGGAGCAGGGTGGGGG - Intronic
928143713 2:28752354-28752376 GGCCTCTGGGAGCGCGGTCAGGG + Intronic
937320409 2:120957389-120957411 GGCTTGTGGGAGCACCGTGTAGG - Intronic
940292794 2:152094156-152094178 GCCCTCTGGGAGCCCCTTGTTGG + Intronic
942522287 2:176817186-176817208 GTACTCTGAGAGCAGTGTGTAGG - Intergenic
943079877 2:183245978-183246000 GCACTCTGGGAGCACGGTTCTGG + Intergenic
946410012 2:219511099-219511121 GTCCTCTGGGTGCAGGGGGAGGG + Intergenic
947878831 2:233486861-233486883 GTCCTCTGGCCGCACTGTGCTGG - Intronic
1170546306 20:17437994-17438016 GTCCTCTGGGAGCACGGTGTGGG - Intronic
1172161967 20:32875163-32875185 GCCATATGGGAGCACTGTGTTGG - Intronic
1173484961 20:43434350-43434372 GCACTCTGGGAGCCCAGTGTGGG + Intergenic
1175714834 20:61248307-61248329 TTTCTCTCGGAGCACTGTGTTGG - Intergenic
1176276097 20:64270223-64270245 GTCATGTGAGTGCACGGTGTGGG + Intronic
1178086076 21:29113401-29113423 GGCCTCTGGGAGAACAGTGAAGG - Intronic
1178330365 21:31685345-31685367 ATCCTCTTGGAGCTGGGTGTAGG - Intronic
1179266202 21:39805715-39805737 GTCCCCTGGGAGGACTGTGCTGG + Intergenic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
1181941706 22:26483232-26483254 GTCCTCTGGGAACAAGGGATGGG - Intronic
1185275126 22:49947446-49947468 GTCCACTGGGAGCCAAGTGTGGG + Intergenic
958700902 3:97587840-97587862 GTCTTCTAGGATCACTGTGTTGG + Intronic
961976035 3:131026502-131026524 CTCCTCTGGGAGGACAGAGTAGG - Exonic
964334018 3:155635435-155635457 GTCCTCTCAGAGCAGGCTGTAGG - Intronic
970993593 4:22239654-22239676 CTCCTCTTGGAGTACGGGGTGGG + Intergenic
974478690 4:62417722-62417744 GTGCTCTGGGAGCAGGGAGGAGG + Intergenic
979280744 4:118865016-118865038 GACCTCTGGGGGCAAGGTTTGGG - Intronic
1202762911 4_GL000008v2_random:127189-127211 GTTCACTGGGAGCAGCGTGTCGG + Intergenic
985900160 5:2782523-2782545 GTCCTCTGTGACCACGGACTAGG - Intergenic
995115440 5:108472956-108472978 CTCCCGTGGGAGCATGGTGTGGG + Intergenic
995429339 5:112056787-112056809 GTACTCTGGGAGGATGATGTGGG + Intergenic
999433405 5:151543243-151543265 GTCCTCTGGGTTCACTGAGTAGG + Exonic
1000433485 5:161179807-161179829 GTCCTCTGGGAGCTAGGGCTTGG - Intergenic
1001265868 5:170274285-170274307 GTCCTTTGTGAGTATGGTGTGGG - Exonic
1001280221 5:170381449-170381471 GTCCTCTGGAATCACTGTGAAGG - Intronic
1004342592 6:14820524-14820546 GTCCTCTGGGAGGCCGAGGTGGG - Intergenic
1004368115 6:15029093-15029115 GGCCTCAGGCAGCACTGTGTGGG - Intergenic
1011182238 6:84633986-84634008 GTCCACTGGGACCACAGTGCAGG - Intergenic
1011976552 6:93308019-93308041 GTGCTCTTGGTGCAGGGTGTAGG + Intronic
1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG + Intergenic
1019307662 7:343534-343556 GTCCTCTGGTCTCACGGTGCTGG - Intergenic
1019379678 7:714265-714287 CTCCTCTAGAGGCACGGTGTGGG - Intronic
1027956750 7:84888063-84888085 GTGCAATGGGTGCACGGTGTGGG + Intergenic
1029452238 7:100647531-100647553 CTCCTGTGGGGGCACAGTGTAGG + Exonic
1032080967 7:128858261-128858283 GCCGTCAGGGAGCAGGGTGTGGG + Intronic
1032091281 7:128912899-128912921 GCCGTCAGGGAGCAGGGTGTGGG - Intergenic
1033216350 7:139496211-139496233 GTGATTTGGGAGCAGGGTGTGGG - Intergenic
1037675927 8:21050709-21050731 GACCTCAGGGAGCACGCTGCCGG - Intergenic
1037808844 8:22074114-22074136 GTCCTCTGGTAGCTTGCTGTTGG + Intronic
1039653818 8:39376288-39376310 GCACTTTGGGAGCACGATGTGGG - Intergenic
1047394150 8:124478969-124478991 GCACTCTGGGAGGACGATGTGGG - Intronic
1048611134 8:136024385-136024407 GTTCTCTGGGAGCACGTGGCTGG + Intergenic
1052795337 9:32918783-32918805 GTGCACTGGGAGGACGGGGTGGG + Intergenic
1052842517 9:33305046-33305068 GTCCCCTGGAAGAACAGTGTGGG - Intronic
1053084908 9:35210768-35210790 GCACTTTGGGAGGACGGTGTGGG - Intronic
1053299381 9:36937807-36937829 GTCCTCTGAGTTGACGGTGTAGG - Intronic
1053308861 9:37002729-37002751 GTCCTCGGTGAGCACGGATTCGG - Exonic
1054804373 9:69383820-69383842 GTTCTCTGGGGGCAGGGGGTGGG - Intronic
1055647515 9:78375137-78375159 GGCACCTGGAAGCACGGTGTTGG - Intergenic
1056081740 9:83102322-83102344 GTCCTCTGGGAGGCCGAAGTGGG - Intergenic
1057522771 9:95772981-95773003 ATCCTGTGGGTGCCCGGTGTGGG + Intergenic
1059452772 9:114381160-114381182 GTCCTCTAGGAGCTCGGGGCTGG + Exonic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062574837 9:137201169-137201191 GTCCGCTGAGAGCGCGGTGCAGG + Intronic
1062597063 9:137304247-137304269 GCCCTGTGTGAGCTCGGTGTGGG + Intergenic
1203543674 Un_KI270743v1:112070-112092 GTTCACTGGGAGCAGCGTGTCGG + Intergenic
1187174837 X:16886943-16886965 GTCCTCTGGCAGTGGGGTGTAGG + Intergenic
1187274722 X:17807234-17807256 GTCCTTTGGGAGCCCAGTGAGGG - Intronic
1188094345 X:26003318-26003340 CTCCTATGGGAGCTTGGTGTGGG + Intergenic
1189444398 X:41067229-41067251 ATCCACTGGGATCACAGTGTGGG + Intergenic
1190076797 X:47322772-47322794 GCCCACTGGGGGCACGGTGGGGG + Intergenic
1190597610 X:52063828-52063850 GTCACCTGAGAACACGGTGTGGG - Intronic
1190611214 X:52190245-52190267 GTCACCTGAGAACACGGTGTGGG + Intronic
1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG + Intergenic
1194626288 X:96230019-96230041 GTCATCTGGGAGCAAGGTCCTGG - Intergenic
1194839823 X:98726568-98726590 GTCCTCTGGGAGCAAGGGCCTGG + Intergenic
1198058562 X:133020577-133020599 GTCCTCTCTGAGCATGGGGTAGG + Intergenic
1199979099 X:152911310-152911332 GTCTGCTTGGAGCACAGTGTCGG + Intergenic
1200233754 X:154458599-154458621 GTCCTCTTTGGGCAGGGTGTTGG - Intronic
1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG + Intergenic
1200264100 X:154636610-154636632 CTCCTCCGGTAGCACAGTGTAGG - Intergenic
1201325271 Y:12749455-12749477 CTCCTCTGGTATCACGGTTTGGG - Intronic