ID: 1170546566

View in Genome Browser
Species Human (GRCh38)
Location 20:17439897-17439919
Sequence GGACCCGTGACAGCTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 3, 3: 2, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170546566_1170546575 -1 Left 1170546566 20:17439897-17439919 CCAACCACAGCTGTCACGGGTCC 0: 1
1: 0
2: 3
3: 2
4: 92
Right 1170546575 20:17439919-17439941 CCAGGGGAAGGAAGCACATAGGG 0: 1
1: 0
2: 1
3: 38
4: 339
1170546566_1170546577 13 Left 1170546566 20:17439897-17439919 CCAACCACAGCTGTCACGGGTCC 0: 1
1: 0
2: 3
3: 2
4: 92
Right 1170546577 20:17439933-17439955 CACATAGGGCACCAAATGAAGGG 0: 1
1: 0
2: 5
3: 23
4: 150
1170546566_1170546578 14 Left 1170546566 20:17439897-17439919 CCAACCACAGCTGTCACGGGTCC 0: 1
1: 0
2: 3
3: 2
4: 92
Right 1170546578 20:17439934-17439956 ACATAGGGCACCAAATGAAGGGG 0: 1
1: 0
2: 5
3: 20
4: 187
1170546566_1170546576 12 Left 1170546566 20:17439897-17439919 CCAACCACAGCTGTCACGGGTCC 0: 1
1: 0
2: 3
3: 2
4: 92
Right 1170546576 20:17439932-17439954 GCACATAGGGCACCAAATGAAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1170546566_1170546573 -2 Left 1170546566 20:17439897-17439919 CCAACCACAGCTGTCACGGGTCC 0: 1
1: 0
2: 3
3: 2
4: 92
Right 1170546573 20:17439918-17439940 CCCAGGGGAAGGAAGCACATAGG 0: 1
1: 0
2: 3
3: 30
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170546566 Original CRISPR GGACCCGTGACAGCTGTGGT TGG (reversed) Intronic
902880364 1:19368240-19368262 TGAGACGTGCCAGCTGTGGTGGG + Intronic
905617188 1:39409186-39409208 GGGACCGTGACAGCTGCGGGCGG + Intronic
905944794 1:41892454-41892476 GAACCTGTGGCAGCAGTGGTAGG - Intronic
910876698 1:91885510-91885532 GGGCGCGTGACAGCTTCGGTGGG - Intronic
911154065 1:94622263-94622285 TGACCCTTGACAGCTTTGGATGG + Intergenic
914918259 1:151831306-151831328 GGACCCCAGACAGCAGTGGCCGG - Intronic
915636288 1:157189386-157189408 GGAACCGGGAGAGCTGAGGTGGG + Intergenic
916015705 1:160748208-160748230 GGACCCGTGAAAGAGCTGGTCGG + Exonic
918123151 1:181557263-181557285 GAGCCAGTGACAGATGTGGTGGG + Intronic
920646361 1:207806992-207807014 GGACCCATGAACTCTGTGGTGGG - Intergenic
924462524 1:244272141-244272163 AGCCCCCGGACAGCTGTGGTTGG + Intergenic
1062857599 10:787029-787051 GCACCTGTGACAGCTGAGGAAGG - Intergenic
1067166157 10:43868069-43868091 GGGCCAGGTACAGCTGTGGTAGG - Intergenic
1077235463 11:1480059-1480081 GCTCCCGTGACAGCTCTGGATGG - Intronic
1077340868 11:2025778-2025800 TGACCCATGACGGCTGTGGAGGG + Intergenic
1079117249 11:17647700-17647722 GCAGCCATGTCAGCTGTGGTAGG + Intergenic
1080836529 11:35945016-35945038 GGACAGCTGACAGCTGTGGGCGG - Intronic
1083687495 11:64385340-64385362 GGACCTGTGAATGGTGTGGTGGG - Intergenic
1083816243 11:65134061-65134083 GCGCCGGTGACAGCTGTGTTAGG + Intronic
1085019155 11:73194306-73194328 GACCCCTTCACAGCTGTGGTCGG + Intergenic
1202823853 11_KI270721v1_random:80967-80989 TGACCCATGACGGCTGTGGAGGG + Intergenic
1102234100 12:111283446-111283468 TGACTCGTGGCAGCTGTGGAAGG - Intronic
1106413001 13:29524100-29524122 GGACCCGGGACCGCAGTGGCTGG + Intronic
1107614640 13:42152801-42152823 GGACCTGTGACAGGGGTGGGAGG + Intronic
1108490331 13:50975239-50975261 GGCATCGTGACAGCTGTGATGGG - Intergenic
1113150185 13:107254545-107254567 TGAGCCTGGACAGCTGTGGTAGG - Intronic
1113716626 13:112513568-112513590 GGCCCCGTGGCAGCTGTTGATGG + Intronic
1118370467 14:65133372-65133394 GGGCCCCTCACACCTGTGGTGGG - Intergenic
1126274456 15:46860505-46860527 GCACCCGTGGGAGCTGTGATGGG + Intergenic
1128879596 15:71231129-71231151 GCACCCGTGAGCACTGTGGTTGG + Intronic
1131727587 15:95243822-95243844 GGACCCATTTAAGCTGTGGTTGG - Intergenic
1132055188 15:98647291-98647313 GGACCCGAGACAGGTGCGGGTGG + Intergenic
1132404395 15:101533523-101533545 GGACCCGTGAGGGGTGTGGGTGG - Intergenic
1135109102 16:19676876-19676898 GGACCAGTGCCAACTGTAGTTGG - Intronic
1136512033 16:30744008-30744030 GGTCCTGTGACAGCAGTGGTTGG + Intronic
1136790564 16:32965601-32965623 AGGCCAGTGACAGGTGTGGTGGG - Intergenic
1136879250 16:33888331-33888353 AGGCCAGTGACAGGTGTGGTGGG + Intergenic
1140221284 16:73046434-73046456 GGACACGAGAGTGCTGTGGTGGG - Intronic
1140475315 16:75236964-75236986 GGACCCTTGACAGCCATGGGGGG + Exonic
1146812772 17:35917077-35917099 GGACCTGTGGAAGCTGTGCTGGG + Intergenic
1147261647 17:39212496-39212518 GGACCAGTGTCAGATGTGGATGG + Intronic
1157312206 18:46560709-46560731 GGACCCAGGACAGGTGTGGCCGG - Intronic
1162352448 19:10158789-10158811 GGGCCTGTGCCAGCTGTGGAAGG - Intronic
1164389362 19:27804991-27805013 GGCCCAGAGGCAGCTGTGGTAGG + Intergenic
1167358275 19:49016978-49017000 AGACCCGTGTGAGCTGTGGAAGG - Intronic
1167362289 19:49036567-49036589 AGACCCGTGTGAGCTGTGGAAGG - Exonic
926076182 2:9944913-9944935 GGACACGTGGCAGCCGTGGCAGG - Intergenic
931231065 2:60375362-60375384 TGACCCCTGACCCCTGTGGTTGG + Intergenic
933725316 2:85423698-85423720 TGACTCGGGACAGCTGTGATGGG - Intronic
936153300 2:110033183-110033205 GTACCCGTGACTGCTGTGGTGGG + Intergenic
936191381 2:110338232-110338254 GTACCCGTGACTGCTGTGGTGGG - Intergenic
938393901 2:130927447-130927469 TGACCCATGACAGGTGAGGTTGG + Intronic
948455175 2:238101499-238101521 GGACCCCTGACACCTGTGGTAGG + Intronic
1170546566 20:17439897-17439919 GGACCCGTGACAGCTGTGGTTGG - Intronic
1171338107 20:24405950-24405972 GGCCCACTGACTGCTGTGGTGGG - Intergenic
1175991898 20:62793971-62793993 TCACCAGTGCCAGCTGTGGTTGG + Intergenic
1176413090 21:6459285-6459307 GGACCTGTGAGAGCTGGGGCAGG - Intergenic
1178734279 21:35134811-35134833 GGACTCCTCTCAGCTGTGGTTGG - Intronic
1179688585 21:43067607-43067629 GGACCTGTGAGAGCTGGGGCAGG - Intronic
1180161324 21:45999835-45999857 GGACCCGTGACGGCCATGGGAGG + Intronic
1180876054 22:19175738-19175760 GGCCCGGAGGCAGCTGTGGTAGG + Exonic
1182754729 22:32669589-32669611 GTAACAGTGACAGCAGTGGTGGG + Intronic
1184046639 22:41976523-41976545 GGACCAGTGGCAGCTGCGGGCGG - Intronic
954396462 3:50295905-50295927 GGACTTGTGACAGTTGTGGGAGG - Intronic
959528855 3:107408903-107408925 GGACCAGGGAAAGCAGTGGTGGG - Intergenic
959799847 3:110480027-110480049 TGACTGGTGACAGCTGTCGTTGG + Intergenic
960939030 3:122921826-122921848 GGACCCGGGAGACCTGGGGTCGG - Intronic
961446534 3:126983914-126983936 GGAGCGGTGGCAGCTGTGGTCGG - Intergenic
961820366 3:129572736-129572758 GGACCAGGGGCAGCTGTGGGAGG + Exonic
968532920 4:1104699-1104721 GGGCCAGTGACAGTGGTGGTGGG - Intronic
968922360 4:3528900-3528922 GGACGCTTGAGAGCTGGGGTGGG + Intronic
981290778 4:143071943-143071965 AGACCAGAAACAGCTGTGGTAGG - Intergenic
982222522 4:153137151-153137173 GGTCCCATGTCAGCTATGGTGGG + Intergenic
984754467 4:183312971-183312993 GGACCTGTGAGAGATGTGGGAGG + Intronic
984802145 4:183725225-183725247 GGACCCCTGAAGGCTGTGGAGGG - Intergenic
985546732 5:513687-513709 GGCCCAGGGACAGCTCTGGTGGG + Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
997600172 5:135133725-135133747 GGCCCTGTGACAGTTCTGGTGGG + Intronic
997653921 5:135541781-135541803 TGACCCATGACAGTTGTGGAAGG + Intergenic
1000838052 5:166180193-166180215 TGCCCCATGACATCTGTGGTGGG + Intergenic
1001669127 5:173459405-173459427 GGATCCCTGACAGCTGGGGATGG + Intergenic
1002280014 5:178124434-178124456 TGATCAGTGACACCTGTGGTCGG - Exonic
1019497975 7:1349354-1349376 GGCCCAGTGACAGCCGTGGCTGG - Intergenic
1019641681 7:2106775-2106797 GGACTCATGACAGCTGGGGAGGG - Intronic
1023981674 7:45074086-45074108 GGCCCCGTGCCAGGTCTGGTAGG + Intronic
1025638726 7:63348702-63348724 GGCCCAGAGGCAGCTGTGGTAGG + Intergenic
1025643970 7:63399387-63399409 GGCCCAGAGGCAGCTGTGGTAGG - Intergenic
1036221176 8:6922796-6922818 GGACCAGTCAGAGCTGTAGTAGG - Intergenic
1042879289 8:73469529-73469551 GGAGACGGGACAGATGTGGTAGG + Intronic
1053275046 9:36776816-36776838 GGATCCATGAAAGGTGTGGTGGG - Intergenic
1055250904 9:74304127-74304149 GGACACTTGACAGTTGGGGTGGG + Intergenic
1056382021 9:86064382-86064404 GGCCCCGTGACAGATGGGATAGG - Intronic
1057308834 9:93928640-93928662 GGACCTGAGACAGCTGGGGAGGG + Intergenic
1061495840 9:130973744-130973766 GCACCCATGACAGCTGGGGCAGG - Intergenic
1062503180 9:136859903-136859925 GGGTCTGTGCCAGCTGTGGTTGG + Exonic
1062613892 9:137387400-137387422 GGACCCATGGCAGGTGTGGCGGG + Intronic
1190517246 X:51236279-51236301 GCACCAGTGGTAGCTGTGGTGGG - Intergenic
1200145994 X:153926746-153926768 GGAGCCTTGAGAGCTGGGGTGGG + Intronic