ID: 1170548978

View in Genome Browser
Species Human (GRCh38)
Location 20:17459393-17459415
Sequence GTATCTGTATGTTCACCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170548978_1170548979 0 Left 1170548978 20:17459393-17459415 CCTTTTGGTGAACATACAGATAC 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1170548979 20:17459416-17459438 ATTTCTGTTGAGCGTCTACTAGG 0: 1
1: 0
2: 1
3: 18
4: 131
1170548978_1170548982 16 Left 1170548978 20:17459393-17459415 CCTTTTGGTGAACATACAGATAC 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1170548982 20:17459432-17459454 TACTAGGGAGTCAAAATGTTGGG 0: 1
1: 0
2: 3
3: 8
4: 118
1170548978_1170548981 15 Left 1170548978 20:17459393-17459415 CCTTTTGGTGAACATACAGATAC 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1170548981 20:17459431-17459453 CTACTAGGGAGTCAAAATGTTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1170548978_1170548980 1 Left 1170548978 20:17459393-17459415 CCTTTTGGTGAACATACAGATAC 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1170548980 20:17459417-17459439 TTTCTGTTGAGCGTCTACTAGGG 0: 1
1: 0
2: 2
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170548978 Original CRISPR GTATCTGTATGTTCACCAAA AGG (reversed) Intronic
900510452 1:3057156-3057178 TAATCTGTGTGTCCACCAAATGG - Intergenic
902097860 1:13961196-13961218 GTCTCTGTGTGTTGAACAAAAGG + Intergenic
902499893 1:16903474-16903496 GTATATGTATATGCAACAAAAGG - Intronic
902818993 1:18932160-18932182 GGATCTTTATGATGACCAAATGG - Intronic
903781862 1:25825716-25825738 GTACTTGTATTTTCACCAGAGGG + Intronic
909342709 1:74549584-74549606 GTATCTGTCTTTTAACCAATGGG + Intergenic
910010263 1:82452746-82452768 CCATGTGAATGTTCACCAAAGGG + Intergenic
910565596 1:88639347-88639369 TTATGTGAATGCTCACCAAAGGG - Intergenic
911987172 1:104641970-104641992 GAGTCTGTATCTTCACAAAAAGG - Intergenic
915288223 1:154866346-154866368 GTATCTGCCTGCTCAACAAATGG - Intronic
915615848 1:157037654-157037676 GAATCGTTATGTACACCAAAAGG - Intronic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
917283317 1:173399640-173399662 CCATGTGAATGTTCACCAAAGGG + Intergenic
919587794 1:199460709-199460731 TTATTTGTATATTCACAAAAAGG - Intergenic
920577982 1:207076682-207076704 GTGTCTATATGTTGACCAACTGG + Exonic
921274347 1:213503981-213504003 CAATCTGAATGTTCATCAAAAGG + Intergenic
923293062 1:232565689-232565711 GAATCTGTATGTGCAGTAAAAGG - Intergenic
924149098 1:241109599-241109621 GTGTTTGTATGTTCACCAACAGG + Intronic
1063264939 10:4437198-4437220 GTATGTGTATGATCGCCAGATGG + Intergenic
1064072937 10:12246176-12246198 GAATCTGTGACTTCACCAAATGG - Exonic
1066803181 10:39212841-39212863 GTTTCTGTATATTCTGCAAATGG - Intergenic
1068547715 10:58368701-58368723 GTATCTGTAGATACACAAAAAGG - Exonic
1075365918 10:121888649-121888671 GTGTCCGTATGTTTACCAAAAGG + Intronic
1077075905 11:702062-702084 GTATCTGTATGTGAACAAGAGGG - Intronic
1078487958 11:11741401-11741423 GTGTCTATATGTACACCATATGG + Intergenic
1086119476 11:83290975-83290997 GTTTCTGTATGTTTTACAAATGG + Intergenic
1087021520 11:93608049-93608071 CTATGTGAATGCTCACCAAAGGG - Intergenic
1087872800 11:103318592-103318614 ATATCTATATATTCACCTAAAGG - Intronic
1089419838 11:118323257-118323279 GTATCTGTATGTTTAATGAAAGG + Intergenic
1090276411 11:125422842-125422864 GTATTTGTATGCTCACAGAAGGG + Intronic
1091384546 12:84605-84627 GTATATGTGTGTCCACCAAGAGG + Intronic
1095244036 12:39898117-39898139 GTACATGTATGTTCACCAGAAGG - Intronic
1096592854 12:52673427-52673449 GTTTCTGTGTGTTTAACAAAAGG + Intergenic
1098807266 12:75035625-75035647 GCATGTGAATGGTCACCAAAGGG + Intergenic
1099571471 12:84324895-84324917 GTATACGTATGTTCTCCAGATGG + Intergenic
1100083443 12:90879187-90879209 GTAGCTGTCTGATCACCACAAGG - Intergenic
1100232051 12:92618620-92618642 TCATGTGAATGTTCACCAAATGG + Intergenic
1102885102 12:116516015-116516037 GTAGCTGATTGTTCTCCAAAAGG - Intergenic
1105410726 13:20169148-20169170 GGCTTTGTATGTCCACCAAAAGG + Intergenic
1106030688 13:25999466-25999488 GCATCTGGATGGTCAGCAAAGGG + Intronic
1107505249 13:41027274-41027296 TTATGTGAATGCTCACCAAAGGG + Intronic
1109623864 13:64948244-64948266 CTATCTTTATGTTCACAAGATGG - Intergenic
1110284085 13:73729801-73729823 TTTTCTGTAAGTTCACCATAGGG + Intronic
1111072776 13:83189757-83189779 GTATTCTAATGTTCACCAAAGGG - Intergenic
1111776162 13:92665057-92665079 GTATCTATATTTTCATCATATGG - Intronic
1111927892 13:94482691-94482713 AAAACTGTATGTTCATCAAAAGG + Intergenic
1114883331 14:26814056-26814078 GTGTCTGTATGTAGGCCAAAAGG - Intergenic
1114975578 14:28093111-28093133 GTATTCACATGTTCACCAAAAGG - Intergenic
1115839742 14:37455916-37455938 GTAAGTCTATGTTTACCAAATGG + Intronic
1117296575 14:54385947-54385969 GTATCTGTATGTGACCCAGATGG - Intergenic
1118091683 14:62487737-62487759 GTATCTACATGTTCAGCAGATGG + Intergenic
1119590983 14:75887720-75887742 ATATCTGTCTGTACAGCAAATGG + Intronic
1119593095 14:75908719-75908741 GTATTTGTCTGTTCATCAGAGGG + Intronic
1121295549 14:92818815-92818837 GTTTCTATATTTTCCCCAAATGG - Intronic
1125390720 15:39190017-39190039 GAATACATATGTTCACCAAAAGG - Intergenic
1127232751 15:57014769-57014791 TTATCTGTATATTCACCAAATGG - Intronic
1128041277 15:64575668-64575690 GTATTTGTATATTTACAAAAAGG + Intronic
1134825425 16:17280738-17280760 GTATCTGTAAGTTTGACAAAAGG + Intronic
1137424727 16:48368274-48368296 TTAGCTGTATTTTCTCCAAAGGG + Intronic
1138440498 16:57031710-57031732 GTATCTTTATGTTCTCCCCAAGG - Intronic
1139622548 16:68158314-68158336 GTATCTGGACTTTCATCAAATGG + Intronic
1143329986 17:6126864-6126886 GTATCTCCATGTTCACCACATGG + Intergenic
1143694642 17:8603285-8603307 CTATCCGGATGTGCACCAAAGGG - Intronic
1144490977 17:15708915-15708937 GCATATATTTGTTCACCAAAAGG - Intronic
1146079655 17:29766883-29766905 ATATCTGAATTTTCACCAAGAGG + Intronic
1147011105 17:37448965-37448987 GTCTCTGTATATTCACCTACTGG + Intronic
1149941625 17:60875120-60875142 GTATCTGTCATTTAACCAAAAGG + Intronic
1150769032 17:68025793-68025815 TTATATGGATGTTCACCCAAAGG + Intergenic
1152547140 17:81006154-81006176 GTAACTGGATGTTCACCCATAGG + Intronic
1153471394 18:5450239-5450261 TTATCTGTATGATCATGAAATGG + Intronic
1153679815 18:7489994-7490016 GTATCTGTAGATTCTTCAAAAGG - Intergenic
1155296328 18:24387824-24387846 CTACCTGAATGTTCACCTAAGGG - Intronic
1158716474 18:59884618-59884640 GTACGTACATGTTCACCAAAAGG - Intergenic
1159411618 18:68083959-68083981 GCATGTGTATATTTACCAAAAGG - Intergenic
1166326905 19:42056646-42056668 GTATCTGTGTGCTCACCGCAGGG + Exonic
926231884 2:11010539-11010561 GTATCTGTGTGTTCTCAAATGGG - Intergenic
929642151 2:43592776-43592798 TTGTGTGTATGTTCACTAAAAGG - Intronic
930495917 2:52143430-52143452 AAATCTGTATGTTCTACAAAGGG - Intergenic
933207594 2:79526360-79526382 ATATATGTATGTTCACAAATGGG + Intronic
937800773 2:126077992-126078014 ATATTTGTATGCTCACTAAAGGG + Intergenic
938242708 2:129755725-129755747 GTTTCTTTATCTTCAACAAAGGG - Intergenic
939249480 2:139666170-139666192 CTATCTTTATGTTCATGAAAAGG - Intergenic
939474238 2:142665662-142665684 GCATCTGTATGTTCTTCCAATGG - Intergenic
939738282 2:145877047-145877069 GTATCTATATGTTCACAAATTGG + Intergenic
940497391 2:154450012-154450034 CTATTTGCATGTTTACCAAATGG + Intronic
941318321 2:164022723-164022745 GTATCTGTAAGATCTCCAAATGG + Intergenic
941696286 2:168554925-168554947 GTGTCTGTATATTCATAAAAAGG + Intronic
946222289 2:218238214-218238236 GTATCAGTATGGCCAGCAAATGG - Intronic
946565871 2:220965255-220965277 GTATTTGTCTGTTTTCCAAAAGG - Intergenic
1169148626 20:3271425-3271447 ACTTCTGTATTTTCACCAAAAGG - Intronic
1170377835 20:15720727-15720749 ATACCTCTTTGTTCACCAAAGGG + Intronic
1170548978 20:17459393-17459415 GTATCTGTATGTTCACCAAAAGG - Intronic
1170778617 20:19403443-19403465 GGGTCTGTTTGTTCACCACATGG - Intronic
1171176336 20:23052805-23052827 GAATGGGTAAGTTCACCAAAAGG - Intergenic
1173263549 20:41458131-41458153 GCATCTGAATGTACACCAAGAGG + Intronic
1174151841 20:48491456-48491478 GTATATGTATGATGAGCAAATGG + Intergenic
1178700829 21:34832899-34832921 GTTTCTGTTTGTTTACAAAAGGG + Intronic
949908405 3:8878900-8878922 GAAACTGTATTTTCACTAAAAGG + Exonic
951675474 3:25235446-25235468 GTATCTGTCTCCTCACCAAAAGG + Intronic
952538645 3:34342175-34342197 GTATAAACATGTTCACCAAAAGG - Intergenic
953095878 3:39776497-39776519 GTCTCTGTGTGTGCACCTAACGG + Intergenic
959192992 3:103139459-103139481 GTCCCTATATGTTCACCACATGG - Intergenic
959246754 3:103880386-103880408 GTAGCTGTATAATCACAAAAGGG + Intergenic
964819036 3:160749970-160749992 GTTTTTCTATGTTCCCCAAATGG - Intergenic
965023527 3:163266972-163266994 GTATCAGTATTTTCAGTAAATGG + Intergenic
965124562 3:164608976-164608998 GTATCTGTATCTTCAGCCCATGG + Intergenic
966661400 3:182418689-182418711 CCATGTGAATGTTCACCAAAGGG + Intergenic
975248437 4:72148135-72148157 GTGTGTGTATTTTCCCCAAATGG + Intergenic
977472699 4:97461086-97461108 GTGTATATATGTGCACCAAAAGG - Intronic
978485827 4:109252532-109252554 TTATGTGAATGCTCACCAAAGGG - Intronic
979114560 4:116807012-116807034 GTATTTATATGATAACCAAAGGG - Intergenic
980869835 4:138598226-138598248 GTATGAGTATGTTCTCTAAATGG + Intergenic
985505094 5:274764-274786 GTTCCTGTATTTTCACCAGAGGG + Intronic
985743027 5:1630871-1630893 GTTCCTGTATTTTCACCAGAGGG - Intergenic
986513711 5:8538419-8538441 ATATATATATTTTCACCAAATGG + Intergenic
987674347 5:21055192-21055214 TTATCTGTGTGATCACCAATTGG - Intergenic
988250633 5:28753284-28753306 ATATCTGTATGTTCTGCCAAGGG + Intergenic
992867476 5:80972157-80972179 GCACATGTATGTACACCAAAAGG - Intronic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
1001654519 5:173339317-173339339 GTATGTGTATGTCGTCCAAATGG + Intergenic
1001754185 5:174155166-174155188 GTATGTGCGTGTTTACCAAATGG - Intronic
1004298668 6:14437350-14437372 CCATGTGAATGTTCACCAAAAGG + Intergenic
1004371009 6:15052005-15052027 ACATCTGTATGTTGAACAAATGG + Intergenic
1005344149 6:24872934-24872956 ATATCTGGAGGTTCACCAGACGG - Exonic
1009244497 6:61219393-61219415 CCATGTGAATGTTCACCAAAGGG - Intergenic
1009260524 6:61480291-61480313 GTTTTTGTATGTTCTGCAAATGG + Intergenic
1010578879 6:77568925-77568947 GTATATGTATGTTCAATGAATGG - Intergenic
1010605297 6:77882243-77882265 GTATCAGTGTGTTCACTAACCGG + Intronic
1012252475 6:96993968-96993990 GTATCTCTATGTAGAGCAAAGGG - Intronic
1012964214 6:105656035-105656057 CCATGTGTATATTCACCAAAGGG + Intergenic
1014669005 6:124276283-124276305 GTGTGTGTGTGTTCACCAAGGGG - Intronic
1015500229 6:133924152-133924174 TTTTCTGTATGTTCACAATAGGG + Intergenic
1015708553 6:136114577-136114599 GTATCTGTAAGGTTACTAAAAGG - Intronic
1016565668 6:145450476-145450498 GTATATGTATTCTCACCAAAAGG + Intergenic
1017452403 6:154566246-154566268 CCATATGAATGTTCACCAAAGGG + Intergenic
1018173384 6:161159613-161159635 GTGTGTGTGTGTTCATCAAAAGG + Intronic
1018786594 6:167113235-167113257 GTATCTGAATGTGCACCTGAGGG - Intergenic
1021150995 7:17150786-17150808 GTATCTGTATATTGTCCTAAGGG + Intergenic
1027621917 7:80498183-80498205 TTATCTGTATGATTACCAAATGG - Intronic
1031152015 7:118065046-118065068 ACATTTGCATGTTCACCAAATGG + Intergenic
1031682128 7:124688043-124688065 CTATGTGAATGTTCATCAAAGGG + Intergenic
1033981609 7:147171521-147171543 GAATCTGTTGGTTAACCAAATGG + Intronic
1035447744 7:158954451-158954473 GTTTCTCTATGTTTCCCAAAAGG - Intronic
1036197219 8:6730003-6730025 GTATATATATGTTCAGCAAAAGG - Intronic
1038811183 8:30846520-30846542 TAATCTGCATTTTCACCAAAAGG + Exonic
1039626461 8:39059595-39059617 CCATGTGAATGTTCACCAAAGGG - Intronic
1043707683 8:83373206-83373228 TTATCTGAATGTACATCAAAAGG + Intergenic
1048483660 8:134827422-134827444 GTATATGTATGTCCACTACATGG - Intergenic
1053573632 9:39335590-39335612 GCATCTGTCTGTTTTCCAAATGG + Intergenic
1053838253 9:42164149-42164171 GCATCTGTCTGTTTTCCAAATGG + Intergenic
1054095199 9:60894274-60894296 GCATCTGTCTGTTTTCCAAATGG + Intergenic
1054123512 9:61283419-61283441 GCATCTGTCTGTTTTCCAAATGG - Intergenic
1054591090 9:67012362-67012384 GCATCTGTCTGTTTTCCAAATGG - Intergenic
1054761457 9:69008011-69008033 GTAACAATATGTTCAGCAAATGG - Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055191411 9:73529405-73529427 GTATCTATATGTACAGAAAAAGG + Intergenic
1056525994 9:87443503-87443525 CCATCTGAATGCTCACCAAACGG - Intergenic
1058102328 9:100931049-100931071 TTTTCTGTATGTTTACCAAAGGG + Intergenic
1059605379 9:115829112-115829134 GTAGCTGTATGTTGACCACTGGG + Intergenic
1187451679 X:19402489-19402511 CAATATATATGTTCACCAAAAGG + Intronic
1188433151 X:30129747-30129769 CTGCCTGTATTTTCACCAAAAGG + Intergenic
1188694481 X:33173361-33173383 GTTTATGTATTTTCATCAAAAGG + Intronic
1188852978 X:35154617-35154639 GTAACTCTATCTTCAGCAAATGG + Intergenic
1189032368 X:37463589-37463611 CCATGTGAATGTTCACCAAAGGG - Intronic
1190774631 X:53542932-53542954 GTTTCTGTTTGCTCACAAAAGGG + Intronic
1193470158 X:81891081-81891103 CTATGTGAATGCTCACCAAAGGG + Intergenic
1195422059 X:104686715-104686737 GTGTATTTATGTTCACCAACAGG - Intronic
1197522065 X:127511052-127511074 TCATGTGAATGTTCACCAAAGGG + Intergenic
1199579951 X:149351125-149351147 GGCTCTGTATATTCACCCAAGGG - Intergenic
1199644721 X:149896250-149896272 GTATGTGTATGTTCAGAACAGGG - Intergenic