ID: 1170549564

View in Genome Browser
Species Human (GRCh38)
Location 20:17465298-17465320
Sequence TACAGGAAGCAGAGAGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 585}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170549564_1170549570 1 Left 1170549564 20:17465298-17465320 CCTCTTGCTCTCTGCTTCCTGTA 0: 1
1: 0
2: 5
3: 44
4: 585
Right 1170549570 20:17465322-17465344 CCAGCCTGGGTCTGACCTGGCGG 0: 1
1: 0
2: 3
3: 50
4: 344
1170549564_1170549571 2 Left 1170549564 20:17465298-17465320 CCTCTTGCTCTCTGCTTCCTGTA 0: 1
1: 0
2: 5
3: 44
4: 585
Right 1170549571 20:17465323-17465345 CAGCCTGGGTCTGACCTGGCGGG 0: 1
1: 0
2: 2
3: 31
4: 305
1170549564_1170549568 -2 Left 1170549564 20:17465298-17465320 CCTCTTGCTCTCTGCTTCCTGTA 0: 1
1: 0
2: 5
3: 44
4: 585
Right 1170549568 20:17465319-17465341 TATCCAGCCTGGGTCTGACCTGG 0: 1
1: 1
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170549564 Original CRISPR TACAGGAAGCAGAGAGCAAG AGG (reversed) Intronic
900731112 1:4260973-4260995 AGCAGGAAGAAGAGAGGAAGGGG - Intergenic
900753226 1:4414369-4414391 CACAGGAAGGAGAAAACAAGGGG - Intergenic
903216848 1:21848095-21848117 TGCAGGAAGCAGATGGCAGGAGG + Intronic
903285762 1:22275781-22275803 TTCAGGGAGCGGACAGCAAGAGG - Intergenic
903453729 1:23472499-23472521 AACAGGAGGCAGAGAGCAAAGGG + Intronic
903524084 1:23979920-23979942 GGCAGGAAGCAGGGAGAAAGGGG + Intronic
903561850 1:24233948-24233970 AGCAGGAAAAAGAGAGCAAGGGG + Intergenic
903918989 1:26786353-26786375 AACAGGAAACAGAGCGGAAGAGG + Intergenic
904151691 1:28446808-28446830 AACAGGAGCAAGAGAGCAAGGGG - Intronic
905005957 1:34710679-34710701 GCCAGGAAGCAGGGAGCAAAGGG - Intergenic
906430381 1:45750959-45750981 CACAAGAATCAGAGTGCAAGCGG - Intergenic
906678276 1:47708755-47708777 GAAAGGAACCAGAGAGCCAGGGG - Intergenic
907246342 1:53111465-53111487 GACAGGAAGCAGAGAGGAAGCGG + Intronic
907318346 1:53586997-53587019 AACAGGAGGCACAGAGAAAGGGG + Intronic
908057128 1:60299773-60299795 GAGAGGAGGCTGAGAGCAAGGGG - Intergenic
908792644 1:67798206-67798228 CACAGGAAGCAGAGTTCAGGTGG - Intronic
908854115 1:68405352-68405374 AAAAGGAAGGAGAGAGGAAGAGG + Intergenic
909197863 1:72649407-72649429 TTCAGGAAGCCGAGACCTAGGGG + Intergenic
910455976 1:87397652-87397674 TATATGATGCAGAGAGTAAGTGG + Intergenic
910841788 1:91568326-91568348 TACAGTCAGCTGAGAGCAAATGG + Intergenic
910985733 1:93003002-93003024 TGCGTGGAGCAGAGAGCAAGAGG - Intergenic
911558354 1:99373900-99373922 TACATGAAGCAGAAAGGAACTGG + Intergenic
911878207 1:103197122-103197144 CACAGGAAGCAAAGATCATGAGG - Intergenic
912950634 1:114118098-114118120 GACAGGAAGGAGGGAGCATGGGG + Intronic
912969401 1:114266480-114266502 TAAAGGAAGAAGGGAGCATGGGG + Intergenic
913252637 1:116924660-116924682 TACAGAAAGCGCAGAGCATGTGG - Intronic
913534210 1:119755637-119755659 GACGGGAGGCAGGGAGCAAGGGG + Intronic
914348146 1:146817291-146817313 CACAGGAGGCAGGCAGCAAGGGG + Intergenic
914803987 1:150979370-150979392 TACAGAAAGCCGAGGGCCAGGGG + Intergenic
915497675 1:156293211-156293233 TAGAGCAAGCAGAGAGAGAGAGG + Intronic
915645779 1:157270945-157270967 GACAGGGAGCAGAGAGAGAGAGG - Intergenic
917600677 1:176570769-176570791 TGCTGTAAGCAGAGAGCCAGAGG - Intronic
917656807 1:177134728-177134750 TACAGAATGCAAAGAGGAAGTGG + Intronic
918050868 1:180971540-180971562 TACTGGAGGCAGAGAGCAGTCGG - Intergenic
918904864 1:190478509-190478531 TGCAGGAATCAGAGGGGAAGCGG - Intergenic
919681514 1:200440095-200440117 TAAAGAAAGCACAGAGCAATGGG + Intergenic
919795565 1:201319543-201319565 TCCAGGAAGCAGAGAGGCTGGGG + Intronic
919927188 1:202198217-202198239 TGCTGGAGGCAGAGAGTAAGAGG + Intronic
920411441 1:205764496-205764518 TAAAGAAAGCAGATAGGAAGAGG - Intergenic
920589692 1:207205145-207205167 AAGAGGAAGCGGAAAGCAAGTGG - Intergenic
921348341 1:214209664-214209686 GAGAGGAAGCAGAGAGAAAAGGG + Intergenic
921824348 1:219655379-219655401 TAAGGGAAGAAGAGAGCAGGAGG - Intergenic
922482114 1:225946309-225946331 TCCAGGGAGGACAGAGCAAGCGG - Intergenic
922963113 1:229664896-229664918 TAGAGGATGCAGAGAGCCAGCGG - Intergenic
923034444 1:230274630-230274652 GAGAGGCAGCACAGAGCAAGAGG - Intronic
923618407 1:235556984-235557006 CACAGGAGGCAGAGCTCAAGCGG + Intronic
924893367 1:248308639-248308661 GACAGGAGGCAGAGGGCAGGCGG - Intergenic
1064130823 10:12708189-12708211 CACAGGTGGCAGAGTGCAAGAGG - Intronic
1064233261 10:13548784-13548806 GACAGGAGGAAGAGAGTAAGGGG + Intergenic
1064254853 10:13734613-13734635 CAGAGGAAGCAGAGAGTGAGTGG - Intronic
1064259576 10:13774437-13774459 AACAGGAAGCAGGGATGAAGTGG + Intronic
1064606781 10:17050146-17050168 TACAGGAAGAAGAGAGAGAGAGG - Intronic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1065385333 10:25128174-25128196 TACAGAGATCAGATAGCAAGGGG - Intergenic
1065526666 10:26629148-26629170 GACTGGAACTAGAGAGCAAGCGG + Intergenic
1065676852 10:28185509-28185531 AACAGGATGCAGACAGCAAAAGG + Intronic
1065754675 10:28920270-28920292 GACAGGAGGCAGAGCTCAAGTGG + Intergenic
1065998669 10:31083944-31083966 GACAGGAAGCAGACAGAAAGGGG - Intergenic
1066171698 10:32855605-32855627 GACAGGAGGCAGAGCTCAAGTGG + Intronic
1066583007 10:36901138-36901160 ATCAGGGAGCAGAGAGCAAGGGG - Intergenic
1067069048 10:43119314-43119336 AGCAGGAGGCAGAGAGCAAGTGG + Intronic
1067381315 10:45776152-45776174 TGAAGAAAGAAGAGAGCAAGGGG - Intronic
1067708219 10:48626938-48626960 TCCAGGAAGGAGAGAGGAACTGG + Intronic
1067827611 10:49589676-49589698 GGCAGGAAGGAGAGAGCAATGGG + Intergenic
1067889016 10:50116785-50116807 TGAAGAAAGAAGAGAGCAAGGGG - Intronic
1068209052 10:53896702-53896724 TACAGGAGGCAGAGCTCAGGAGG - Intronic
1068681783 10:59827788-59827810 TACAGGAAGGAAAAAGTAAGGGG + Intronic
1069843445 10:71354571-71354593 TGCACGAAGCAGAGGGGAAGGGG - Intronic
1069996137 10:72343263-72343285 CCCAGGAAGCAGGGAGCAGGAGG - Intronic
1070528990 10:77319767-77319789 TGCTGGAAGCAAAGACCAAGAGG + Intronic
1071069388 10:81673746-81673768 TTCAGGAAGTAGAAAGTAAGTGG + Intergenic
1071361550 10:84851280-84851302 TGCAGGAGGGACAGAGCAAGAGG - Intergenic
1071404763 10:85319206-85319228 TACAGGAAGCTCAGAACAAATGG - Intergenic
1071509515 10:86252378-86252400 TGGAGGAAGCACAGAGCAGGAGG - Intronic
1071525194 10:86354304-86354326 GACAGGACCCAGAGACCAAGAGG + Intronic
1073376084 10:103036039-103036061 AACAGAAAGCAGAAAGCAAAAGG - Intronic
1073474449 10:103743693-103743715 TAAAGCAAGCAGACACCAAGAGG + Intronic
1073478320 10:103768919-103768941 GACAGGAAGCAGAGGGCAAGGGG + Intronic
1073882455 10:107998866-107998888 TTCAGAAAGCAGAGAGTAAAAGG + Intergenic
1074773204 10:116746473-116746495 AGGAGGAAGCAGAGAGCATGGGG + Intergenic
1076179033 10:128391646-128391668 AGCAGGAGGAAGAGAGCAAGGGG + Intergenic
1076202372 10:128568768-128568790 TACAGGTGGCAGAGAGAATGCGG + Intergenic
1076206319 10:128607248-128607270 GAGAGGAAGCAGGGATCAAGAGG - Intergenic
1076309390 10:129493353-129493375 TGGAGGAAGCAGAGGGAAAGTGG - Intronic
1076415049 10:130280052-130280074 GACAGGAAGCAGAGCTCAGGAGG - Intergenic
1076863256 10:133152802-133152824 AAAAGGGAGCAGAGAACAAGGGG + Intergenic
1077202729 11:1319668-1319690 TACAGCAGGCAGAGAGGAAAAGG + Intergenic
1077284674 11:1760337-1760359 CTCAGGAGGCAGAGAGTAAGAGG + Intronic
1078116988 11:8463404-8463426 GACAGGAGGCAGAGATCAGGTGG + Intronic
1078329747 11:10409532-10409554 AGCAGGAAGCAGAGGGCAGGGGG + Intronic
1078577386 11:12513671-12513693 GACAGGAAGGAGAGATCCAGTGG + Intronic
1078679745 11:13464071-13464093 GAGAGGAAGCAAAGAGGAAGAGG + Intergenic
1078964446 11:16321682-16321704 ACCAAGCAGCAGAGAGCAAGAGG + Intronic
1080054663 11:27893653-27893675 TAAAGGAAACAGTGAGCATGAGG + Intergenic
1080376032 11:31712952-31712974 TACAAGAATCAGAGAACAAAGGG - Intronic
1080432184 11:32209363-32209385 TACAGGAAGAAAAGAGTAGGGGG + Intergenic
1080876178 11:36276413-36276435 TGCAGGCAGCACAGAGCAATGGG - Intronic
1083162886 11:60866462-60866484 TGCTGGAAGGGGAGAGCAAGAGG - Intergenic
1084028678 11:66467973-66467995 TAGAGGAGGCAGAGGGGAAGTGG + Intronic
1084205340 11:67588346-67588368 TGCAGGAAGCAGCGTGCAGGGGG - Intergenic
1084717711 11:70884070-70884092 GAATGGATGCAGAGAGCAAGAGG + Intronic
1085326777 11:75612410-75612432 GACAGGGATCAGAGGGCAAGAGG + Intronic
1086331572 11:85759710-85759732 GACAGTATGCAGAGAGCTAGAGG - Intronic
1086878081 11:92121752-92121774 TTCAAGAAGGAGAGAGGAAGAGG + Intergenic
1087716549 11:101614864-101614886 CATAGGAAGCAGACAGAAAGAGG - Intronic
1088506838 11:110535364-110535386 TACAGGATGCAGGAAGGAAGAGG + Intergenic
1088813826 11:113408529-113408551 GACAGGGAGCAGAGGGGAAGAGG - Intergenic
1089028070 11:115292910-115292932 TACAGTATGCAAATAGCAAGGGG - Intronic
1089040923 11:115449019-115449041 AACAAGGAGCAGAGACCAAGAGG + Intronic
1089170801 11:116510261-116510283 CAGAGGAAGCAGAGACCCAGAGG + Intergenic
1089683478 11:120132456-120132478 TCCTGGCATCAGAGAGCAAGAGG - Intronic
1089997198 11:122919488-122919510 TACAGCAGGAAGGGAGCAAGGGG + Intronic
1090329058 11:125915739-125915761 TACAGGAACCAGAGAATCAGGGG - Intronic
1090582726 11:128177707-128177729 GACAGAAAGCATAGAGTAAGAGG - Intergenic
1091327829 11:134704399-134704421 TCCAGGAAGCAGAGGAGAAGAGG + Intergenic
1091651922 12:2316997-2317019 AACAGAAAGCAGAAAACAAGTGG + Intronic
1091839962 12:3613746-3613768 TGCAGGAACCAGAGAGCCCGTGG - Intronic
1092103670 12:5905456-5905478 TACAGGGATCAGAGAGGGAGGGG + Intronic
1092613331 12:10193995-10194017 TACAGGAAACAAAGTTCAAGAGG + Intergenic
1092734273 12:11565365-11565387 GACAGGAGGCAGAGATCAGGCGG - Intergenic
1094372619 12:29754330-29754352 TACATGAAGAAGAAAGAAAGAGG + Intronic
1094808808 12:34117753-34117775 TTTAGGAATCAGAGAGAAAGAGG + Intergenic
1095770421 12:45949042-45949064 TACAGGCATCAGAGAGTAAGCGG + Intronic
1096829577 12:54303957-54303979 TTCAGGAATCTGAGAGGAAGGGG - Intronic
1097354639 12:58587382-58587404 GACAGGAGGCAGAGCTCAAGAGG - Intronic
1098016938 12:66115044-66115066 TCCAGGAAGCAGAGACTGAGAGG - Intergenic
1098668087 12:73190013-73190035 TCAAGGAAACACAGAGCAAGAGG + Intergenic
1098972910 12:76874723-76874745 GACAGGAAGCAGAGCTCAGGTGG - Intronic
1099242183 12:80151242-80151264 GATAGGAAGCAGAGACTAAGAGG + Intergenic
1099487019 12:83241384-83241406 TACAGGAAGCATAGATCATTCGG + Intergenic
1099729260 12:86477409-86477431 TAGAGGAGGAAGAGAGAAAGGGG + Intronic
1101707620 12:107235220-107235242 CACAGGATGCAGAGAGAAGGGGG - Intergenic
1102470270 12:113155830-113155852 TGCAGGAAGCAGGGAGACAGAGG - Intronic
1102768416 12:115452420-115452442 TACAGGAGACAGGGAGCAACTGG - Intergenic
1102783719 12:115586884-115586906 AACAGGAGGAAGAGAGCAAGGGG - Intergenic
1103060689 12:117856027-117856049 GAGAGGAAGCAGAGAGAGAGTGG - Intronic
1103640913 12:122351522-122351544 TACAGTTAACAAAGAGCAAGGGG - Intronic
1104604697 12:130179563-130179585 TGGAGGAAGCACAGAGGAAGAGG + Intergenic
1105603040 13:21903905-21903927 CCCAGGAAGCAGAGAGGGAGCGG + Intergenic
1105819542 13:24067310-24067332 CTCAGGAAGCATAGAACAAGAGG - Intronic
1106591311 13:31100983-31101005 TAATGGCAGCTGAGAGCAAGGGG - Intergenic
1107097669 13:36553695-36553717 TCCAGGAAGCTTTGAGCAAGAGG + Intergenic
1107376807 13:39812441-39812463 CACAGAAAGCAAACAGCAAGGGG - Intergenic
1108022519 13:46143019-46143041 TAGAGCAAGCAGAGAGCCACAGG - Intronic
1108217444 13:48199198-48199220 ATCAGGAGACAGAGAGCAAGAGG + Intergenic
1108759208 13:53542491-53542513 TACAGGCAGCCCAGAGCCAGAGG + Intergenic
1110182373 13:72633129-72633151 TAGAGGAAGGAGAGAGGAAGAGG + Intergenic
1110477059 13:75928449-75928471 GACAGGAAGCAGAGCTCAGGTGG - Intergenic
1110542099 13:76718284-76718306 TAAAGGAGGCAGAGTGCAAAAGG - Intergenic
1111997150 13:95176207-95176229 TCCAGGAAGCCGAGGGCAGGGGG + Intronic
1112057842 13:95707202-95707224 GACAGGAAGCAGAGCTCAGGTGG + Intronic
1112597913 13:100826163-100826185 GAAAGGATGCAGAGAGCATGAGG - Intergenic
1113157652 13:107342500-107342522 TCCAGAAAGCAGAGAAGAAGTGG + Intronic
1113305533 13:109074480-109074502 GGCAGGAGACAGAGAGCAAGGGG + Intronic
1113902170 13:113803538-113803560 CACAGAAAGCAGAGAACACGGGG - Intronic
1113904739 13:113813956-113813978 AACAAGCAGCAGAGACCAAGAGG + Exonic
1113914998 13:113864882-113864904 TACAGAAAGCAAAGAGAAACTGG - Intergenic
1113928511 13:113954007-113954029 TCCAGGCTGCAGAGAGAAAGGGG - Intergenic
1114501871 14:23175704-23175726 TCCAGGAACCAGAGAGCTAAAGG - Intronic
1114711381 14:24781676-24781698 TACAGGAAGAAGAGAGAAGGAGG + Intergenic
1114897110 14:27004820-27004842 GACAGGAAGCAGAGCTCAGGCGG - Intergenic
1116416247 14:44681305-44681327 TGCAAGAACAAGAGAGCAAGAGG + Intergenic
1116468985 14:45265812-45265834 AAAAGGAAGGAGAGAGAAAGAGG + Intergenic
1117429243 14:55636456-55636478 TACAAGAAGCTGAGAGAAGGTGG + Exonic
1117971016 14:61250940-61250962 TAAAGGAAGCAGAGTGAAAGTGG + Intronic
1118297834 14:64586493-64586515 AAGAGGAAGCAGAGAACTAGAGG - Intronic
1118475135 14:66109471-66109493 GACAGAGAGCAGAGAGAAAGAGG + Intergenic
1118877542 14:69797699-69797721 TACAGGTAGCATAGTCCAAGGGG + Intergenic
1119029405 14:71179877-71179899 TCCAGGTAGGAGACAGCAAGTGG + Intergenic
1119531873 14:75367482-75367504 TACATGAAGGATAGAGCCAGTGG + Intergenic
1119834604 14:77737212-77737234 TAGACAAAGCAGACAGCAAGAGG + Intronic
1119951310 14:78748568-78748590 GACAGGAGGCAGGCAGCAAGTGG + Intronic
1120165456 14:81194147-81194169 GACAGGAAGCAGAGTTCAGGTGG - Intronic
1120479246 14:85028204-85028226 TACAGGAAGCAGAGGACAGCGGG - Intergenic
1120578847 14:86221120-86221142 GACAGGAGGCAGAGCTCAAGTGG + Intergenic
1120834820 14:89030103-89030125 GCCAGGGAGCAGAGAGCAGGTGG - Intergenic
1121779756 14:96614803-96614825 CGCAGGAAGCAGAGAGAGAGAGG + Intergenic
1121787715 14:96674869-96674891 TTCAAGAAGCAGATGGCAAGAGG - Intergenic
1122877416 14:104675096-104675118 AACAGGAGGAAGAGAGCAAAGGG + Intergenic
1124114628 15:26829979-26830001 TACAGGAGGCAGAGCGCTGGTGG - Intronic
1124254983 15:28132980-28133002 TACAGGAAGGAGATAGGAAGTGG - Intronic
1124870363 15:33535334-33535356 AAGAGGAAGAAAAGAGCAAGAGG - Intronic
1124937099 15:34183848-34183870 TACAAGAAGCAGAGGGGAAAAGG + Intronic
1125655622 15:41354534-41354556 TATAGGAAGCAGAGGACCAGAGG + Intronic
1125787940 15:42339055-42339077 TACAGGAAACAAAGAGCAGCTGG - Intronic
1125908197 15:43413122-43413144 TACAGGAAGCAGTGAAGAAGAGG - Exonic
1126062740 15:44799584-44799606 CACAGAAAGCAAAGAGCAAGGGG - Intergenic
1126893581 15:53233894-53233916 GACAGGAAGCAGACAGCAGAAGG - Intergenic
1126923272 15:53551716-53551738 TAAAGAAAGCAGGGAGCCAGAGG + Intronic
1128113993 15:65094224-65094246 GACAGGAGGCAGAGAGCAGCAGG - Intronic
1128463379 15:67888358-67888380 CACAGGGAGCAAGGAGCAAGTGG + Intergenic
1129389066 15:75211519-75211541 GAGAGGAAGCAGAGACCAAATGG - Exonic
1129503616 15:76062556-76062578 GGCAAGAAGCAGAAAGCAAGAGG + Intronic
1129624090 15:77178831-77178853 TACAGGACTCAGAGAAGAAGAGG - Exonic
1129743438 15:78001463-78001485 TCCAGGGAAAAGAGAGCAAGGGG - Intronic
1130339220 15:82985261-82985283 TACAGGCAACAGAGAGCCATTGG + Intronic
1131342888 15:91619393-91619415 TCCAAGAGGCAGAGAGGAAGTGG - Intergenic
1131447396 15:92511825-92511847 TTCATGGAGCAAAGAGCAAGAGG - Intergenic
1132058151 15:98668131-98668153 CACAGGGTGGAGAGAGCAAGGGG + Intronic
1132783155 16:1639690-1639712 TGCAGAAAGCAGAAAGCAATCGG - Intronic
1133963947 16:10517990-10518012 CAGAGGAAGCAGAGAGCCAGAGG - Intergenic
1134286574 16:12867164-12867186 TCCAGGAGGCAGAGATCATGGGG + Intergenic
1134872485 16:17664507-17664529 TACGGGAGGAAGAGAGGAAGAGG - Intergenic
1135204260 16:20469421-20469443 AACATCAAGCAGCGAGCAAGTGG - Intronic
1135214739 16:20555545-20555567 AACATCAAGCAGGGAGCAAGTGG + Intronic
1135509368 16:23068913-23068935 TACAGGAAGAGGAGAAGAAGGGG + Exonic
1135792558 16:25410613-25410635 CAAAGGAAGGAGTGAGCAAGGGG + Intergenic
1136024823 16:27462608-27462630 TTTGGAAAGCAGAGAGCAAGAGG - Intronic
1136547803 16:30965401-30965423 TACAGGGAGCGGGGAGCCAGGGG + Exonic
1137456418 16:48621364-48621386 AAGAGGAAGCCAAGAGCAAGAGG + Intergenic
1138196417 16:55055468-55055490 GACAGGAAGTAAAGAGGAAGGGG - Intergenic
1138217156 16:55214476-55214498 AACAGGAAGGAGGGAGGAAGGGG + Intergenic
1138231829 16:55343343-55343365 TACATGAACCAGAGAGAGAGAGG + Intergenic
1138347043 16:56326504-56326526 TTCAGGAAGCACCGAGGAAGTGG + Intronic
1138429431 16:56959207-56959229 TACCGGAGTCAGAGGGCAAGAGG - Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1138504479 16:57470995-57471017 TTCAGGACGCAGAGAGCCACAGG - Exonic
1138694826 16:58803344-58803366 GACAGGAGGCAGAGCTCAAGTGG - Intergenic
1139985891 16:70898254-70898276 CACAGGAGGCAGGCAGCAAGGGG - Intronic
1140014708 16:71170484-71170506 TACAGGCAACAGGCAGCAAGGGG + Intronic
1140256268 16:73338928-73338950 GGCAGGAGGAAGAGAGCAAGGGG - Intergenic
1140305881 16:73802256-73802278 TTCAGGAAGGAGGGACCAAGAGG + Intergenic
1140725536 16:77808156-77808178 GACAGGAGGCAGAGTGCAGGTGG - Intronic
1140949851 16:79806662-79806684 TACATAAATCATAGAGCAAGGGG - Intergenic
1141216078 16:82025070-82025092 GACAGGAGGCAGAGCTCAAGAGG + Intergenic
1141437496 16:84008728-84008750 CACTGGCAGCAGAGAGCAAGAGG - Intergenic
1141866984 16:86757223-86757245 GACAGGAAGGAGAGAGAAGGGGG - Intergenic
1144142567 17:12363669-12363691 TAAAGGAAGCAGTGGGAAAGCGG + Intergenic
1144778355 17:17796017-17796039 TGCAGGATTCAGGGAGCAAGAGG - Exonic
1144854098 17:18258549-18258571 GACAGGAAGCGGAGGCCAAGCGG + Intronic
1145903710 17:28505227-28505249 AAAAGGAAGCAGAGAGAAGGAGG + Intronic
1146592781 17:34142729-34142751 TTCAGGAAGCAGGTGGCAAGAGG - Intronic
1146711580 17:35046509-35046531 TACAGGAACCAGAGAGCAGAGGG + Intronic
1147357933 17:39912142-39912164 TCCTGGAAGTAGAGAGCGAGAGG + Intronic
1148044942 17:44737852-44737874 GAGGGGAAGCAGAGAGGAAGAGG - Intronic
1148190433 17:45674938-45674960 TACAGGAGGCAGCTAGAAAGAGG - Intergenic
1148524248 17:48315002-48315024 TCCAGGAAACAGAGAGAAATAGG + Intronic
1148687667 17:49509637-49509659 GTCAGGAAGCAGAGAGCCAGTGG - Intronic
1149118875 17:53136366-53136388 TACAGAAAACAGAAAGCAAATGG + Intergenic
1149941760 17:60877637-60877659 TACAGGAAGAAGAGATCTAGAGG + Intronic
1150444526 17:65218329-65218351 GACTGGAAGCTGATAGCAAGCGG - Intronic
1150882010 17:69040550-69040572 TTCAGGGAGTAGGGAGCAAGAGG + Intronic
1151483245 17:74382792-74382814 TACAGAAGGCAGAGAGCAACCGG - Intergenic
1151720714 17:75854436-75854458 GACAGGATGCAATGAGCAAGGGG + Intronic
1152089551 17:78239193-78239215 TCCAGGCAGCTGAGAGCAGGAGG - Exonic
1152272820 17:79335018-79335040 TCCAGGCAGCAGAGAGGAGGTGG - Intronic
1155325033 18:24656592-24656614 TGCAGGATGCCGAGAGCAGGTGG + Intergenic
1156501505 18:37562479-37562501 TTAAGGAAGGGGAGAGCAAGAGG + Intronic
1156727562 18:40147921-40147943 GACAGGAAGCAGAGCTCAGGTGG + Intergenic
1157311103 18:46553940-46553962 AACAGCAAGGAGTGAGCAAGGGG + Intronic
1157409499 18:47451997-47452019 TAAGGGAAGCAGAGAGAGAGAGG - Intergenic
1157713164 18:49863847-49863869 TTCAGAAAGCAAACAGCAAGGGG + Intronic
1157939573 18:51912661-51912683 TACAGAAAGCAGAATGTAAGTGG - Intergenic
1158251118 18:55488659-55488681 GACAGGAAGGAGAAAGCAAACGG + Intronic
1158305353 18:56099528-56099550 CCCAGGAAGCAGAGAGAATGTGG - Intergenic
1158306758 18:56114772-56114794 TACTGTAAGCAGCCAGCAAGAGG - Intergenic
1158387180 18:57008195-57008217 GACAGGAAGGAGAGGGCAAGCGG - Intronic
1158870805 18:61685924-61685946 TACAGGAAGCATAGTTGAAGAGG + Intergenic
1159153802 18:64556090-64556112 TACATGAAGCGGAGGGGAAGCGG - Intergenic
1159487442 18:69082477-69082499 TACGGGAGGGAGAGAGAAAGGGG + Intergenic
1161024693 19:2030911-2030933 TACAGGAAGCAGAGTGGCTGTGG - Intronic
1161270849 19:3388428-3388450 TGGAGGAAGCAGAGACCCAGAGG + Intronic
1161364422 19:3869828-3869850 CACAGGAGGCAGAGACCATGGGG - Intergenic
1162531324 19:11237924-11237946 GACAGGAAGAAGAGAGGTAGAGG - Intronic
1163083338 19:14959668-14959690 TTCAGGAAGGTGAGAGCATGGGG - Intronic
1163347371 19:16752019-16752041 AACAAGCAGCAGAGAGGAAGGGG + Intronic
1163662300 19:18585795-18585817 GACAGGAAGCAGGAAGCAATGGG - Intronic
1164250316 19:23469878-23469900 GATAGGAAGAAGAGAGGAAGTGG - Intergenic
1165300070 19:34963257-34963279 TGCTGGAACCAGAGAGCAGGTGG - Intronic
1165378183 19:35458876-35458898 TATAGGAAGCACTGTGCAAGAGG - Intergenic
1165683986 19:37802214-37802236 GACAGGAAGCAGAGCTCAGGCGG + Intronic
1166018348 19:40001120-40001142 GACAGGAGGCAGAGATCAAGCGG + Intronic
1166426233 19:42680859-42680881 GGCAGGAAGAAGAGAGCAAGGGG - Intronic
1166471433 19:43082564-43082586 CACAGGCAGCAGAGACCATGGGG - Exonic
1166492204 19:43269426-43269448 CACAGGCAGCAGAGACCATGGGG - Exonic
1167223193 19:48217112-48217134 GACAGGAGGCAGAGCGCAGGCGG + Intronic
1167605947 19:50481321-50481343 TACAGGAAGGAGAGAGGAGTGGG + Intronic
1167945446 19:52984675-52984697 TAGAGTAAACAGAGAGGAAGGGG + Intergenic
1168058096 19:53874693-53874715 CACAGGAAGGAAACAGCAAGAGG - Exonic
1168253132 19:55152227-55152249 TGCAGGAAGGAGACAGGAAGTGG - Intronic
1168455317 19:56503003-56503025 CACAGGAAGCAGAGCTCAGGCGG - Intergenic
1168577840 19:57527851-57527873 TGCAGGGAGCAGAGAGAATGAGG + Intronic
925655556 2:6144364-6144386 CACAGGAAACACAGAGAAAGGGG - Intergenic
926391112 2:12393828-12393850 AACAGGAAGAGGAGAGGAAGTGG + Intergenic
926774811 2:16411599-16411621 TAAAGGCAGAAGAGGGCAAGAGG - Intergenic
928387034 2:30879345-30879367 AAGAGGAAGCAGAGAGCTTGGGG + Intergenic
928491298 2:31785995-31786017 TCCAGGAAGGAGAGAGGAACTGG + Intergenic
929549741 2:42881928-42881950 TACAGGAAGCATGTAGGAAGTGG + Intergenic
929914054 2:46119005-46119027 TCCAGGAGGAAGAGAGCAAATGG + Intronic
930192975 2:48479214-48479236 AACAGGTAGCTGGGAGCAAGAGG + Intronic
931245884 2:60492516-60492538 GTGAGGAAGGAGAGAGCAAGGGG - Intronic
932105246 2:68936127-68936149 TACAGGACCCAGAGAGAAAATGG + Intergenic
932343725 2:70982403-70982425 TAAAGGAAGTAGGGAGCCAGAGG + Intronic
932493808 2:72136905-72136927 TACAGATAGCAGAGAGCCACTGG + Intronic
932738934 2:74276968-74276990 GACCAGAAGCAGAGAGAAAGAGG + Intronic
932745833 2:74332879-74332901 GACAGGGAGCAGAGAGAAAAGGG - Intronic
932844876 2:75124798-75124820 TACAGGAAGCGAAGAGCAGGAGG + Intronic
933242732 2:79941342-79941364 TACAGGAATAAGAGAGGGAGTGG - Intronic
933538514 2:83608677-83608699 AGCAGGAATCAGAGAGTAAGCGG + Intergenic
935177211 2:100660034-100660056 TACAAGAAGAAGAGAGACAGGGG + Intergenic
935227045 2:101061767-101061789 GGCAGGAAGTGGAGAGCAAGAGG - Intronic
935416054 2:102820630-102820652 TTCAGGGAGAAGGGAGCAAGTGG + Intronic
936075122 2:109396924-109396946 TACAGGATTCAGAAAGGAAGAGG - Intronic
936175685 2:110218386-110218408 TTCACGGAGCAGAGAGCAGGAGG - Intergenic
936510590 2:113142092-113142114 TGCAGGGAGCAGAGGGGAAGGGG + Intergenic
936703410 2:115040750-115040772 TACAGGAGGAAGAGAGTGAGGGG - Intronic
937124560 2:119465192-119465214 TACTGGAACCAGAGGGGAAGAGG + Intronic
937436283 2:121884557-121884579 AACAGGATGCAGAGAGCAAGTGG + Intergenic
937485476 2:122310722-122310744 CACAGGCAGAAGTGAGCAAGAGG - Intergenic
937485916 2:122314604-122314626 CACAGGCAGAAGTGAGCAAGAGG + Intergenic
937568566 2:123328739-123328761 GACAGGAAGCAGAGCTCAGGTGG - Intergenic
937875330 2:126820911-126820933 AACTGGAAGCAGAAGGCAAGAGG + Intergenic
938018646 2:127887663-127887685 TGCAGGAGGCAGAAAGCCAGGGG + Intergenic
938378439 2:130823498-130823520 CACAGGAAGCTCAGAGCCAGAGG - Intergenic
939500956 2:142983285-142983307 TAGAGATGGCAGAGAGCAAGAGG + Intronic
940094036 2:149953261-149953283 AAGAGCAAGGAGAGAGCAAGAGG + Intergenic
940507836 2:154578503-154578525 AACAGAACGCAGAGAGAAAGGGG - Intergenic
940812641 2:158262660-158262682 TAGTGGCAGGAGAGAGCAAGGGG + Intronic
940965454 2:159832286-159832308 AACAGGAGGCAGAGCTCAAGCGG - Intronic
941060242 2:160838907-160838929 AACAGGAAGCAAGGAGAAAGTGG + Intergenic
941116008 2:161472873-161472895 GACAGGAGGCAGAGCTCAAGTGG + Intronic
942211591 2:173676741-173676763 AAAAGGAAGCAGAGAGGAAATGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942807462 2:179949065-179949087 TAAAGGCATCAGAGAGCTAGTGG + Intronic
943493026 2:188580710-188580732 TTCTGGAAGCAGAGAGAAAAAGG - Intronic
944115069 2:196177050-196177072 TAAAGGAAGTAGATATCAAGTGG + Intergenic
944173224 2:196801595-196801617 AACAGGAAGCAGTGAACAAGGGG + Intergenic
944281333 2:197901636-197901658 GAGAGGAAGCAGAGACCGAGAGG + Intronic
944417029 2:199489151-199489173 TACAGTAAGGAGAAACCAAGAGG + Intergenic
945390207 2:209256641-209256663 GACAAGAAGCAGAGCTCAAGAGG + Intergenic
945775852 2:214104922-214104944 TACTGGATGCAGTGTGCAAGTGG + Intronic
946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG + Intronic
946431702 2:219629864-219629886 TACAAGGAGGAGAGAACAAGGGG + Intronic
947065437 2:226219146-226219168 GACAGGAAACAGAGGGCAAGAGG + Intergenic
947996622 2:234533491-234533513 GAAAGGAAGAAGAGAGAAAGAGG + Intergenic
948104375 2:235401213-235401235 AGCAGGATGAAGAGAGCAAGGGG - Intergenic
948220076 2:236262546-236262568 AACAGGAGCCAGAGGGCAAGTGG + Intronic
948528772 2:238589765-238589787 TACTGGAAGCACAGGGCAATCGG + Intergenic
948914416 2:241025131-241025153 TACAGGAGGCAGAGCTCAGGTGG - Intronic
948926168 2:241099703-241099725 TGCAGGAACCAGAGTGCAGGAGG - Exonic
1169333042 20:4731363-4731385 TAGAGGAAGCAGGAAGCAAAGGG + Exonic
1169683969 20:8249641-8249663 ACCAGGAAGCACAGAGCAAAGGG - Intronic
1169794519 20:9447391-9447413 CACATAAAGCAGAGAGGAAGTGG - Intronic
1169818873 20:9687186-9687208 TACTGGCAGCTGAGAGCAAATGG + Intronic
1170187052 20:13602754-13602776 GACAGGAAGCAGAGCTCAGGCGG + Intronic
1170549564 20:17465298-17465320 TACAGGAAGCAGAGAGCAAGAGG - Intronic
1170956387 20:20983853-20983875 GGCAGGAAGCAGAGTGCATGGGG + Intergenic
1171503159 20:25610354-25610376 AACAAGAAACAGAGAGCATGGGG + Intergenic
1172494921 20:35373850-35373872 TAGAGTAAACAGAGAGCAAAAGG - Intronic
1172639741 20:36433535-36433557 TACAGGAAGCAGATTTCAGGTGG + Intronic
1173055271 20:39605967-39605989 TACAGACAGCACAGGGCAAGAGG + Intergenic
1173070158 20:39756457-39756479 TACAGGCCAAAGAGAGCAAGGGG + Intergenic
1173206319 20:40997264-40997286 GACAGGAAGCAGAGCTCAGGTGG + Intergenic
1173417789 20:42873011-42873033 CACAGGAAGAACAGAGCTAGAGG + Intronic
1173450073 20:43156203-43156225 GACAGGAACCACAGATCAAGTGG + Intronic
1173497464 20:43529917-43529939 GACTGGAAGCAGAGTGCGAGTGG + Intronic
1173784513 20:45782970-45782992 TAAAGGAAGAAGAGAGAAGGAGG - Intronic
1174142475 20:48425575-48425597 GACAGGATGCAGGGAGCAAACGG - Intergenic
1174482602 20:50841977-50841999 TGCAGGAAGCAGAGTTCAGGGGG + Intronic
1174764753 20:53242537-53242559 AAGAAGAAGCAGAGAGTAAGAGG + Intronic
1175290003 20:57869429-57869451 TAGAGGAAGGAGAAGGCAAGGGG - Intergenic
1175496161 20:59415744-59415766 CACAGGATGGAGAGAGCAGGTGG + Intergenic
1175531527 20:59676464-59676486 TGCAGGAAGCAGAGATGAGGTGG - Intronic
1176006993 20:62870864-62870886 TACAGGAGGATGAGAGGAAGGGG - Intergenic
1176122378 20:63459996-63460018 TACAGGAAGCAGACGGCACCCGG + Intronic
1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG + Intronic
1176333649 21:5575777-5575799 TATGGGAAGCACAGAGCAGGTGG + Intergenic
1176394108 21:6245175-6245197 TATGGGAAGCACAGAGCAGGTGG - Intergenic
1176467311 21:7070999-7071021 TATGGGAAGCACAGAGCAGGTGG + Intronic
1176490872 21:7452777-7452799 TATGGGAAGCACAGAGCAGGTGG + Intergenic
1176509770 21:7685606-7685628 TATGGGAAGCACAGAGCAGGTGG - Intergenic
1177529221 21:22338672-22338694 TACAGGAGGGAGAGAGAGAGAGG - Intergenic
1178605706 21:34034963-34034985 AAAAGGAAGCAGGGAGAAAGAGG + Intergenic
1179096051 21:38315215-38315237 CACAGGAAGCAGCCAGCATGGGG + Intergenic
1181038987 22:20183067-20183089 GACAAGGAGCAGAGAGAAAGAGG - Intergenic
1181383746 22:22528317-22528339 AACAGGAACGACAGAGCAAGAGG + Intergenic
1181780597 22:25190331-25190353 GACAGGACGCAGAGATCAGGTGG + Intronic
1181993048 22:26852264-26852286 TAGAGGAAGCAGGGAGGAGGAGG - Intergenic
1183192652 22:36331651-36331673 AACAGGAAGTACAGAGGAAGGGG + Intronic
1183320020 22:37159567-37159589 TCCAAGAGGCAGAGACCAAGAGG - Intronic
1183872412 22:40749949-40749971 TCCAGGGAGGAGAGAGAAAGTGG - Intergenic
1184922116 22:47613122-47613144 CACAGGAAGCTTTGAGCAAGAGG - Intergenic
949671754 3:6404297-6404319 AAGAGGAAGCAGAGAGGAACAGG + Intergenic
950958350 3:17079192-17079214 GAGAGGATGCAGAGAGCGAGGGG - Intronic
951449495 3:22820264-22820286 AACAGGAGGAAGGGAGCAAGAGG + Intergenic
952525220 3:34203011-34203033 CACAGAAAGCAAACAGCAAGGGG + Intergenic
952799139 3:37271868-37271890 AACAGGAGGCAGAGCTCAAGTGG - Intronic
952876843 3:37952474-37952496 TAAAGGAAGAAGATAGGAAGGGG + Intronic
953288282 3:41634598-41634620 TAGAGGAAGCAGCAAGAAAGCGG + Intronic
954632152 3:52053403-52053425 TACAGGCTGCAGAGAGCATCTGG + Intronic
954808417 3:53233280-53233302 GACAGGGGGCAGAGAGTAAGGGG + Intronic
955177296 3:56629652-56629674 ACCAGCAAGCAGAGAGCAAAGGG - Intronic
955220469 3:57019194-57019216 AAGAGGAACAAGAGAGCAAGGGG + Intronic
955801905 3:62695594-62695616 TACAGGAAGGAGAAAGGAGGAGG - Intronic
956264419 3:67380954-67380976 AACAGGAAGGAGGAAGCAAGTGG - Intronic
956740307 3:72270656-72270678 AACAGGAAGCACAGAGTGAGGGG + Intergenic
957500149 3:81045331-81045353 TAAATGAAGAAGAGAGGAAGAGG - Intergenic
957509631 3:81170435-81170457 AAGAGGAAGCAGACAGCAGGAGG + Intergenic
957756492 3:84494831-84494853 TACTGAAGGCAGAAAGCAAGGGG - Intergenic
958414466 3:93857528-93857550 TTCAGGAAGCAAAGAGACAGAGG + Intergenic
958560360 3:95741877-95741899 AACAGGCAGAAGAGAGCAAACGG + Intergenic
958560636 3:95744007-95744029 AGCAGGAAGAAGAGAGCAAATGG + Intergenic
958867743 3:99520751-99520773 TCCTGGCTGCAGAGAGCAAGAGG - Intergenic
959177768 3:102938046-102938068 TACTGGATGCCAAGAGCAAGTGG - Intergenic
961463835 3:127069730-127069752 ACCAGGAAGGAGAGAGGAAGGGG + Intergenic
962121314 3:132563188-132563210 TACAGTAATCAGTGAGCAAAAGG - Intronic
962956880 3:140274806-140274828 ATCACAAAGCAGAGAGCAAGCGG + Intronic
963778762 3:149465785-149465807 GACAGGAACCAGATGGCAAGAGG + Intergenic
963967515 3:151389293-151389315 TTCAGGAAGAATAGAGGAAGAGG - Intronic
964267801 3:154920388-154920410 AGCAGGAGGAAGAGAGCAAGGGG + Intergenic
964960848 3:162423266-162423288 TACAGAAAGCAGAAAGAAGGTGG - Intergenic
965070035 3:163907991-163908013 TTCAGGGAGCAAAGAGCAGGAGG - Intergenic
965392145 3:168118020-168118042 TACAGGAAGAAGACAGGAAATGG + Intergenic
965625186 3:170677773-170677795 TACACAGAGCAAAGAGCAAGAGG + Intronic
965969292 3:174533570-174533592 TACAGGAACCACAGAGGAGGTGG + Intronic
966820226 3:183918151-183918173 TAGTGGAAGCAAAGAGGAAGAGG + Intergenic
967489709 3:190076287-190076309 TCCAGGAAGCAGGGAGCACTTGG - Intronic
967516508 3:190375540-190375562 TACACAAAGCAGATAGCAGGGGG + Intronic
968582452 4:1401425-1401447 GAAAGGGAGCAGAGAGCAACTGG + Intergenic
968868116 4:3226850-3226872 GACAGGAAGCAGGGAGCTACTGG + Intronic
969237138 4:5873536-5873558 CACAGGAAGAAGAGAGAGAGTGG + Intronic
969561495 4:7950923-7950945 CACAGGGAGCAGAGGACAAGGGG + Intergenic
970258174 4:14191673-14191695 TTCAAGAAGCAGAGAGAATGTGG - Intergenic
970641075 4:18066614-18066636 TATAGGAAGAAGAGGGAAAGAGG - Intergenic
971001946 4:22333112-22333134 CAGAGGAAGAAGAGAGCAAAGGG - Intergenic
971359409 4:25922873-25922895 TACAGGCAGCAGAAAAGAAGGGG + Intronic
971615651 4:28787925-28787947 TACAGGAAGCAGGGAGAGGGTGG + Intergenic
971728666 4:30347834-30347856 TTCAGGAAGAAGGGAGAAAGTGG + Intergenic
971827648 4:31646625-31646647 GACAGGAAGCAGAGCTCAGGCGG - Intergenic
972585517 4:40433934-40433956 TACAGTAAGAAGAGATCAAAAGG + Intronic
973329195 4:48895494-48895516 TGCATGAAACAGAGAGCAAGAGG + Intronic
973656582 4:53054511-53054533 AACAGGTAGCAAAGAACAAGAGG + Intronic
974572195 4:63667340-63667362 TACAGTAAGAAGAAAGCAAAGGG - Intergenic
974864225 4:67560971-67560993 GTCAGGGAGAAGAGAGCAAGAGG + Intronic
976555687 4:86449011-86449033 GACAGGAAGCAGAGCTCAGGCGG + Intronic
976793666 4:88908858-88908880 TGCAGCAAGCAGCGAGCAAGGGG + Intronic
978317656 4:107457565-107457587 TACAGGAGACAGAGCTCAAGTGG - Intergenic
979287407 4:118941653-118941675 GACAAGAAGCAGACAGAAAGGGG - Intronic
979557479 4:122066088-122066110 GACAGAAGGCAGAGAGCAGGCGG + Intergenic
980552675 4:134360190-134360212 TAGAGGATGGAGAGAGAAAGGGG + Intergenic
980595052 4:134943951-134943973 TACAGTAAGAAGAGAGAAAATGG + Intergenic
980910840 4:138992944-138992966 GACAGGAGGCAGAGATCAGGCGG - Intergenic
981538359 4:145823820-145823842 CACAGAAAGAATAGAGCAAGAGG - Intronic
982156899 4:152532587-152532609 TTTAGGAAGAAAAGAGCAAGTGG - Intronic
982611679 4:157582182-157582204 TACAGAAAGGAGAGAGACAGAGG - Intergenic
982717084 4:158820303-158820325 TACAGGAATCAGAGTAGAAGTGG - Intronic
983012941 4:162571783-162571805 TAAAAAAAGCAGAGAGAAAGAGG + Intergenic
983386975 4:167076385-167076407 TACTGGAGGCAGAGAGTATGTGG + Intronic
984443108 4:179798091-179798113 TGGAGTAACCAGAGAGCAAGAGG - Intergenic
984616847 4:181907744-181907766 CGCAGGAATCATAGAGCAAGCGG + Intergenic
984725753 4:183018957-183018979 TATAGGAAGCCTTGAGCAAGGGG - Intergenic
984875230 4:184362011-184362033 AACAGGAGCAAGAGAGCAAGGGG + Intergenic
985821552 5:2164056-2164078 GGCAGGAAGCAGAGGGCCAGAGG - Intergenic
985842637 5:2320253-2320275 TGCAGGAACCAGAGAGCTTGCGG + Intergenic
986354049 5:6906619-6906641 AACTGGAGGCAGAGAGCCAGGGG + Intergenic
986404493 5:7412118-7412140 TCCAGGAAGCAGAGAAGAAACGG - Intronic
987755370 5:22094188-22094210 TCCAGGAAGCAGTGAACATGGGG + Intronic
988517586 5:31918079-31918101 AACAGGAGCCAGAGAGCAAGGGG + Intronic
990223047 5:53617274-53617296 TTCAAGAAGCAGAGAGTAAGAGG - Intronic
990273136 5:54167321-54167343 GAGATGAAGCCGAGAGCAAGGGG - Intronic
990505608 5:56441270-56441292 TACAGGAAACACTCAGCAAGGGG + Intergenic
990757714 5:59093829-59093851 TACAGGAAAGAGAGAGACAGAGG + Intronic
991209024 5:64083721-64083743 TAAAGGAAGGAGAGAACAAGAGG - Intergenic
991997207 5:72400062-72400084 GAAAGGAAGGAGAGAGCAAGGGG - Intergenic
992520974 5:77551048-77551070 TAGAGGAAGGAGAGAGAGAGGGG + Intronic
993004069 5:82412200-82412222 TTCAGGAAGCAAAGGGCAAGAGG - Intergenic
993704174 5:91150807-91150829 GACAGAATGCAGAGAGCAATGGG - Intronic
994159034 5:96535128-96535150 TACAGAAAGCAGAGAATGAGAGG + Intronic
994352413 5:98762428-98762450 TCCAGGAACCAGACACCAAGTGG + Intergenic
994446980 5:99888506-99888528 AACAGGAGAGAGAGAGCAAGGGG - Intergenic
995671811 5:114612626-114612648 CACAGGAAGAAGAGAGCATAAGG - Intergenic
996566343 5:124883072-124883094 TAGGGGAGACAGAGAGCAAGTGG - Intergenic
997477535 5:134153609-134153631 TAAAGGGTGCTGAGAGCAAGAGG + Exonic
997789211 5:136742065-136742087 GACAGGAGACAGAGAGCAAAAGG - Intergenic
998157247 5:139794019-139794041 TACAGGTAGCAGAGGGCAGGGGG + Intergenic
998232667 5:140371297-140371319 GACAGGAAAAAGAGAGTAAGAGG - Intronic
1000270360 5:159678186-159678208 AGCAGGAGGAAGAGAGCAAGTGG + Intergenic
1000656398 5:163884315-163884337 TACAGGAGGCAGAGCACAGGTGG + Intergenic
1000668852 5:164034610-164034632 AGCAGGAACAAGAGAGCAAGGGG + Intergenic
1001203716 5:169742615-169742637 CTCAGGATGCAGAAAGCAAGTGG - Intronic
1001264383 5:170262262-170262284 TACAGGTAGCAGACAGGAAATGG - Intronic
1001494023 5:172175330-172175352 CAGGGGAAGCAGAGAGAAAGGGG + Intronic
1002701271 5:181126969-181126991 GACAGGAAGCAGGGAGGGAGGGG - Intergenic
1002820119 6:717095-717117 CTGAGAAAGCAGAGAGCAAGGGG + Intergenic
1003000375 6:2326097-2326119 AACAGGAAGAAGAGAGCTGGGGG - Intergenic
1003332995 6:5145076-5145098 CACAGAAAGCAGAGAACAACGGG + Intronic
1003358812 6:5403536-5403558 TACAGGAAGCATGAAGCCAGGGG - Intronic
1004036853 6:11932643-11932665 TACAGGAAGCAGGGAGCCAGAGG + Intergenic
1004223653 6:13767918-13767940 TAAGGGAAGCAGATAGTAAGTGG + Intergenic
1004460291 6:15828846-15828868 TACAGGGAGCAGAGAGGGAGTGG - Intergenic
1005199636 6:23329257-23329279 CACAGGAGGCAGTGAGCAATAGG - Intergenic
1006257039 6:32840196-32840218 TAGAGGAAGAAGAGATCAGGAGG - Intergenic
1006467868 6:34206820-34206842 GACGGGAAGCAGCGAGAAAGGGG - Intergenic
1006857106 6:37141913-37141935 AAGCAGAAGCAGAGAGCAAGTGG + Intergenic
1008067628 6:47066801-47066823 GACAGGAGGCAGAGTTCAAGTGG - Intergenic
1008122471 6:47634053-47634075 GACAGGAAGCAGAGAGCCTGTGG - Intergenic
1009858639 6:69295602-69295624 TAGAGGAAGGAGAGAGTGAGAGG + Intronic
1010024418 6:71199146-71199168 GACAGAAAGTAGAGAGAAAGTGG + Intergenic
1010740301 6:79495087-79495109 GACAGGATGCAGAGCTCAAGTGG - Intronic
1011258234 6:85445831-85445853 AACAGGTGGCAGACAGCAAGAGG + Intergenic
1011310321 6:85973814-85973836 GACAGGAAGCAGGGAGCAATGGG + Intergenic
1011372684 6:86654770-86654792 CATAGGAAGCAGAGAGAAAGAGG + Intergenic
1011497069 6:87947381-87947403 TACAGGAACCAGGTAGCAGGAGG + Intergenic
1013775977 6:113678747-113678769 CATAGAAAGCAAAGAGCAAGAGG - Intergenic
1014043093 6:116851706-116851728 AGCAGGAAAGAGAGAGCAAGTGG - Intergenic
1014102502 6:117527306-117527328 TACAGGGAGCAGGGATCATGGGG + Intronic
1014352014 6:120357498-120357520 TCCAGCAAGCACAGAACAAGTGG + Intergenic
1014541000 6:122676286-122676308 GACAGGAGGCAGAGCTCAAGTGG + Intronic
1015519636 6:134117492-134117514 TGCTGTAAGCAGAGACCAAGAGG + Intergenic
1016046114 6:139482338-139482360 TGGAGGAAGCAGAAAACAAGAGG - Intergenic
1017207182 6:151815865-151815887 AACACGAAGTAGATAGCAAGAGG - Intronic
1017752025 6:157496911-157496933 GAGAGGAAGAGGAGAGCAAGAGG - Intronic
1019112771 6:169730332-169730354 TACAGGCAGCAGAAATCAACAGG + Intergenic
1019485505 7:1287532-1287554 TGCAGGGGCCAGAGAGCAAGAGG + Intergenic
1019676427 7:2315328-2315350 TGCAGGATGCAGAGAGTGAGTGG - Intronic
1019676510 7:2316437-2316459 TGCAGGATGCAGTGAGTAAGTGG - Intronic
1019964114 7:4484839-4484861 GAGAGGAAGGAGAGAGAAAGGGG + Intergenic
1020475975 7:8594931-8594953 TGCAGGAAGCAGACACCAAAAGG + Intronic
1020989828 7:15182909-15182931 TACAGGAGGAAGAGAGAGAGTGG + Intergenic
1022192599 7:28031468-28031490 ACTAGGAAGCAGAGAGCAGGAGG + Intronic
1022684958 7:32588348-32588370 TTCAGGAACCAGTGACCAAGTGG - Exonic
1023622687 7:42088834-42088856 CACAGGCAGCAGACAGCCAGTGG - Intronic
1023679097 7:42665418-42665440 AACAGGAAGAAGAGAGCTTGGGG - Intergenic
1023728751 7:43170101-43170123 GACAGGAGGCAGAGCTCAAGCGG - Intronic
1024370702 7:48580645-48580667 GAGAGGAAGAAAAGAGCAAGGGG - Intronic
1024690412 7:51795384-51795406 GACAGGAGGAAGAGATCAAGTGG + Intergenic
1024816133 7:53274285-53274307 TTCAGCAAGCAGAGAGGAACTGG - Intergenic
1025607212 7:63047935-63047957 TGGAGGAAGCAGAGAGTCAGAGG - Intergenic
1026043064 7:66885034-66885056 GACAGGAGGCAGAGATCAGGTGG - Intergenic
1026287810 7:68978708-68978730 TAGAGGAGGGAGAGAGGAAGAGG - Intergenic
1026647781 7:72187444-72187466 TACAGGAGGCAGAGCTCAGGAGG - Intronic
1027205343 7:76093489-76093511 GACAGGAGGCAGAGATCAGGTGG + Intergenic
1028171840 7:87607055-87607077 GAGAGGAAGAAGAGAGAAAGAGG + Intronic
1029453282 7:100654823-100654845 TAGAGCAAGAAGAGAGCAGGAGG + Intronic
1030073698 7:105719220-105719242 TACTGGAAGAAGAGAAGAAGGGG - Intronic
1030099339 7:105931358-105931380 AAGAGGAAGAAGAGAGGAAGGGG - Intronic
1031104489 7:117524271-117524293 ATCATGAAGCAGAGAGCAAGGGG - Intronic
1031432503 7:121689497-121689519 GGCAGGAGACAGAGAGCAAGAGG - Intergenic
1031524368 7:122807033-122807055 TACTGTAAGGACAGAGCAAGAGG + Intronic
1031684176 7:124712115-124712137 AAAAGGAAGGAGAGAGAAAGAGG + Intergenic
1031999812 7:128257622-128257644 GACAGGAAACAAAGAGCAGGGGG - Exonic
1032366619 7:131306081-131306103 GGCAGGAGGGAGAGAGCAAGGGG - Intronic
1032704817 7:134412673-134412695 GGCAGGAAGGAGAGAGGAAGAGG + Intergenic
1032975879 7:137221744-137221766 AACTGGCAGTAGAGAGCAAGGGG + Intergenic
1033731751 7:144187400-144187422 AACAGGGAGAAGAGAGGAAGAGG - Exonic
1033742600 7:144285983-144286005 AACAGGGAGAAGAGAGGAAGAGG - Intergenic
1033751303 7:144363631-144363653 AACAGGGAGAAGAGAGGAAGAGG + Exonic
1035081361 7:156219208-156219230 TGCAGGGAGCACAGAGCAGGAGG + Intergenic
1035658141 8:1326893-1326915 TACAGGGAGAAGAGAAAAAGTGG + Intergenic
1035822632 8:2610726-2610748 ACCAGGAGGTAGAGAGCAAGTGG - Intergenic
1036494403 8:9256883-9256905 TCCAGAAAGCAGTGAGCAAATGG + Intergenic
1036573249 8:10000330-10000352 TTCAGGATGCAGAAAGAAAGAGG - Intergenic
1036777718 8:11625091-11625113 TGGAGGAAGCAGAGAGTCAGAGG + Intergenic
1037033927 8:14142833-14142855 GGCAGGAGGAAGAGAGCAAGGGG - Intronic
1037210228 8:16377131-16377153 AACATGAAGCAGAGAGAATGAGG - Intronic
1037376734 8:18238337-18238359 GACAGGAGGCAGAGCTCAAGGGG + Intergenic
1038167358 8:25098767-25098789 TGCAGGGAGCAGAGAACAAAAGG + Intergenic
1038492882 8:27982702-27982724 TAAAGGCATCAGAGAGCAAGGGG + Intronic
1038774755 8:30518843-30518865 TAGATGGAGCAGAGAGTAAGTGG + Intronic
1039678117 8:39694683-39694705 TAGGGGAAGCAGAGAGGGAGAGG - Intronic
1041463779 8:58139076-58139098 TAATGGAAACACAGAGCAAGAGG + Intronic
1041483922 8:58353285-58353307 AACAGGAACGAGAGTGCAAGGGG + Intergenic
1041692791 8:60705095-60705117 TATAGGAAGGAGAGAGTAAAGGG + Intronic
1042409173 8:68442533-68442555 TCTGAGAAGCAGAGAGCAAGTGG + Intronic
1042876519 8:73445227-73445249 TTCAGGGACCAGAGAGGAAGGGG + Intronic
1043283541 8:78500814-78500836 TACAGGAAGCTGACAGAAACTGG + Intergenic
1043531953 8:81161017-81161039 TAAAGGAAGGAGATAGGAAGTGG + Intergenic
1043597818 8:81904486-81904508 TACAAGAAGCAGAGCTGAAGGGG - Intergenic
1045551878 8:103180222-103180244 TCCAGGAAGAAGAGAACAACTGG + Intronic
1045895369 8:107209815-107209837 AAAAGGAAGCAGAAAGCAGGGGG - Intergenic
1046586532 8:116155273-116155295 AACAGGAAGGAAAGAGAAAGGGG + Intergenic
1046614761 8:116463828-116463850 GACAGGAGGCAGAGAGCAGCTGG - Intergenic
1046622486 8:116543091-116543113 GACAGGAAGCAGAGCTCAGGCGG + Intergenic
1047218072 8:122895165-122895187 TAAAGAAGGGAGAGAGCAAGAGG - Intronic
1047412077 8:124631956-124631978 AACAGAAAGCAAAGAGAAAGAGG + Intronic
1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG + Intergenic
1047628635 8:126681923-126681945 AACAGAAAGCAGGGAGCATGTGG + Intergenic
1048399659 8:134052606-134052628 TACAGGAAGAAGAGAGAATGGGG + Intergenic
1048487643 8:134863470-134863492 TCCAGAAGGCAGAGAGCAAGTGG - Intergenic
1048799956 8:138186171-138186193 TACTGGAACCAGGGAGCGAGAGG - Intronic
1049191217 8:141288811-141288833 GACAGGAAGACGAGGGCAAGGGG + Intronic
1049299525 8:141862253-141862275 CACAGGACACACAGAGCAAGGGG - Intergenic
1049315451 8:141964595-141964617 AACAGGTAGCAGAGAGCAGAGGG + Intergenic
1050109400 9:2199542-2199564 AACAGGAGGAAGAGAGCAAAGGG + Intergenic
1050131263 9:2415141-2415163 TACAGGAGGCAGAGCTCAGGTGG + Intergenic
1050377171 9:4985246-4985268 TGCAGGAAGGAGAGAGGAAGAGG + Exonic
1051034672 9:12729439-12729461 TAATGGAAGCAGAGAGCACAAGG + Intergenic
1051623950 9:19080306-19080328 TACATGAAGCAGAAAGGAAAAGG - Intronic
1051849944 9:21494699-21494721 GACAGGAGGCAGAGCTCAAGAGG + Intergenic
1053160341 9:35809641-35809663 TACAGAAAGTAGGGAGGAAGGGG - Exonic
1053512300 9:38698658-38698680 TCTAAGAAGCAGAGGGCAAGAGG - Intergenic
1054925642 9:70586038-70586060 TTCAGGAAGATGAGAGCAGGAGG - Intronic
1055329472 9:75168815-75168837 TACAGGAAGAAGTCAGAAAGAGG - Intergenic
1056177743 9:84051902-84051924 TACTGGGAGCAGGGAGTAAGAGG - Intergenic
1056761889 9:89421248-89421270 TTCCGGAGGCAGAGAGCAATGGG + Intronic
1056812770 9:89777089-89777111 GGCAGGGAGCAGAGAGCCAGGGG + Intergenic
1056857066 9:90140657-90140679 TCCATTAAGCAGAGAGGAAGTGG - Intergenic
1056858941 9:90161898-90161920 TACAGGAAGAAGTAAGCAACTGG - Intergenic
1056954949 9:91074258-91074280 GCCAGGAAGCCCAGAGCAAGAGG - Intergenic
1057077401 9:92145699-92145721 TGCTGGAGGCAGAGAGTAAGGGG + Intergenic
1057882575 9:98803621-98803643 TATTGGAAGGAGAGAGCAGGGGG + Intergenic
1057982971 9:99680957-99680979 GACAGAAAGCAAAGAGGAAGGGG + Intergenic
1058287140 9:103192234-103192256 GACAGGAAGCAGAGCTCAGGTGG - Intergenic
1058634918 9:107029126-107029148 AACTGGAAGCAGAGAGGAAATGG - Intergenic
1058871871 9:109209173-109209195 TAGAGGAAGTATAGAGCAACTGG + Intronic
1058986480 9:110212695-110212717 TCTAGAAAGTAGAGAGCAAGGGG - Intergenic
1059488282 9:114644421-114644443 TAAAGGAGGCAGAGAGCAGCAGG - Intronic
1059786657 9:117593603-117593625 AACAGGAGGAAGAGAGCAAAGGG - Intergenic
1059885847 9:118743836-118743858 GACAGGAGGCAGAGCTCAAGTGG + Intergenic
1060422561 9:123479821-123479843 TAAAGGAAGCAAGAAGCAAGAGG - Intronic
1061488222 9:130931041-130931063 TAGAGGAAGGAGAGAGGATGGGG - Intronic
1061761649 9:132855849-132855871 TACAGGCAGAAGGGGGCAAGAGG - Intronic
1203428047 Un_GL000195v1:59440-59462 TATGGGAAGCACAGAGCAGGTGG - Intergenic
1185929804 X:4189760-4189782 GAGAGGTAGGAGAGAGCAAGAGG + Intergenic
1186900216 X:14046474-14046496 AACAAGAAGCAGATAGCAACAGG + Intergenic
1187136765 X:16555481-16555503 TACCGCCAGCAGAGAGTAAGAGG + Intergenic
1188245862 X:27835233-27835255 TACATGAGCCAGGGAGCAAGAGG + Intergenic
1188527960 X:31106686-31106708 TAGAAGAGACAGAGAGCAAGAGG + Intronic
1188811044 X:34655215-34655237 TTCAGGAGACAGAGAGAAAGGGG + Intronic
1189023714 X:37370028-37370050 TAATAGAAGCAGAGAGTAAGTGG - Intronic
1189184362 X:39040236-39040258 TAGAGGAAGGAGGGAGTAAGGGG + Intergenic
1189996950 X:46648012-46648034 TAGAGTAAGGAGAGAGCAACTGG - Intronic
1191024138 X:55895171-55895193 AAGATGAAGGAGAGAGCAAGGGG + Intergenic
1191677459 X:63806693-63806715 TGCAGGAAGCAAAGAGCTAATGG - Intergenic
1192038894 X:67596082-67596104 AGCAGGAACAAGAGAGCAAGGGG - Intronic
1192346651 X:70314495-70314517 TATAGGAAGCAGACAGCAGATGG + Intronic
1193186709 X:78521979-78522001 TGCAGGAGGCAGAGAGCAAGAGG + Intergenic
1193329781 X:80223224-80223246 TGGTGGAAGGAGAGAGCAAGGGG - Intergenic
1194700082 X:97103405-97103427 TTAAGGAAGCAGAGAGAAAAAGG - Intronic
1196428248 X:115594509-115594531 TACACGAAGCAGAAAGCTATCGG - Intronic
1196934202 X:120713420-120713442 AACAGGAAGAAGAGAGAAGGGGG - Intergenic
1197640135 X:128958826-128958848 TAGAGCAGGAAGAGAGCAAGAGG + Intergenic
1198678495 X:139156322-139156344 ACCAGGAAGCAGAGATCATGGGG - Intronic
1198990608 X:142510082-142510104 TACAAGAAGCAGACAGCATCTGG + Intergenic
1201420791 Y:13796372-13796394 AACAAGCAGCAAAGAGCAAGGGG - Intergenic