ID: 1170550861

View in Genome Browser
Species Human (GRCh38)
Location 20:17474845-17474867
Sequence CTGAGCCCACAGATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170550861 Original CRISPR CTGAGCCCACAGATGGAATG AGG Intronic
900596994 1:3484456-3484478 CAGAGCCCACAGGTGGCATCTGG - Intergenic
900807668 1:4778334-4778356 CTAAGCCCAGAGAAGGACTGAGG - Intronic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
902519831 1:17009973-17009995 CTGAGCCCACAGAAGCCCTGGGG - Intronic
902616049 1:17624155-17624177 CTGAGGTCACAGGTGGGATGGGG - Intronic
902654614 1:17858954-17858976 CTGAGTCTGCAGATGGAGTGAGG - Intergenic
903152704 1:21423475-21423497 CTCTGCCCACAGATGGGCTGAGG + Intergenic
903160425 1:21484510-21484532 CTCTGCCCACAGATGGGCTGAGG - Exonic
903240338 1:21978475-21978497 CAGAGCCCACGGTGGGAATGAGG - Intronic
903244085 1:22003109-22003131 CAGAGCCCACGGTGGGAATGAGG - Intronic
904497512 1:30895519-30895541 CTGAACCCAGAGATGAAGTGTGG - Intronic
904557093 1:31372553-31372575 CTGAACCCAGAAAGGGAATGGGG - Intronic
904990345 1:34587666-34587688 CTGAGCAAAGAGATTGAATGAGG - Intergenic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
907951279 1:59186488-59186510 AAGGGCTCACAGATGGAATGAGG - Intergenic
908259016 1:62325302-62325324 CTGAGCAAAGAGGTGGAATGAGG + Intergenic
909326936 1:74363306-74363328 CTTAGCCCACAGTTAGCATGAGG + Intronic
911041763 1:93596884-93596906 CTGAGCCCACAGCTGCTGTGTGG - Intronic
911301168 1:96176147-96176169 CTGACCCTACAGATGGCGTGGGG + Intergenic
912108117 1:106306400-106306422 AGGAGCCCACAGTAGGAATGGGG - Intergenic
913257041 1:116963117-116963139 CTGTGCCCACAGAGCTAATGTGG + Intronic
913542365 1:119834103-119834125 CTCTGCCCGCAGATGGACTGAGG + Intergenic
915940265 1:160114396-160114418 CTGGGCACAGAGATGGAGTGAGG - Intergenic
918505595 1:185250537-185250559 ATGAGCTCACAGAGGGAAAGTGG - Intronic
921349297 1:214219163-214219185 CTGAACCCTCAGATGGAATGAGG + Intergenic
921958613 1:221010984-221011006 CTGAGCCCCCAGGAGGAAAGGGG - Intergenic
922566090 1:226602580-226602602 CTGTGCCCACAGCTGGCCTGAGG + Exonic
923680190 1:236112525-236112547 CTCAGCCCACAGAGTGACTGTGG + Intergenic
924494817 1:244576738-244576760 CTGAGCCTAGAAATGGAAGGTGG - Intronic
1064318373 10:14278674-14278696 CTGAGCCCAGAATTTGAATGGGG + Intronic
1064791670 10:18963251-18963273 CTGAGCCCACACAAGGAAATAGG + Intergenic
1067473793 10:46553542-46553564 CTGAGGAGACAGGTGGAATGAGG + Intronic
1067924146 10:50490701-50490723 TTGAGCCCACAGATAGTAAGTGG - Intronic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1073588285 10:104731894-104731916 CTGAGCCCATAGCTGGAAGGTGG - Intronic
1075039037 10:119093002-119093024 CTGTTCCCAGAGCTGGAATGCGG - Intergenic
1075262333 10:120973996-120974018 TAGAGCCTACAGAAGGAATGTGG - Intergenic
1075382886 10:122033140-122033162 CTGAGCCCACACAGGTACTGGGG + Intronic
1075948616 10:126458606-126458628 CTGAGCTCACAGCAGGAAAGGGG + Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078662535 11:13298983-13299005 CTGCGCCCCCAGCTGGCATGTGG + Intronic
1083446802 11:62713549-62713571 CTGACCCCAAGGCTGGAATGGGG - Exonic
1083775100 11:64890729-64890751 CTGAGCTCACAGATGGGGAGAGG + Intergenic
1084032690 11:66490393-66490415 CTGAGACTCCAGAAGGAATGCGG - Intronic
1084635475 11:70389550-70389572 TTGAGGCCACAGAATGAATGAGG - Intergenic
1084732339 11:71081661-71081683 CTGAGCCTCCAGAGGGAATGAGG - Intronic
1087783180 11:102323027-102323049 CTTAGCCTACAGATGGCATCTGG + Exonic
1088753868 11:112868928-112868950 CTGAGGCCACAGGAGGAAAGAGG - Intergenic
1088993506 11:114975321-114975343 CTGATGCTACTGATGGAATGAGG + Intergenic
1090948539 11:131452327-131452349 CTGAGACCACCAATGGACTGTGG - Intronic
1094318090 12:29154129-29154151 TTGAGCACATAGATGGAATATGG + Intronic
1094373968 12:29770475-29770497 ATAACCCCACAGATGGAATTAGG - Intronic
1094524566 12:31223071-31223093 CTGTGCACACAGTTGGGATGAGG - Intergenic
1096814414 12:54192762-54192784 AAGTCCCCACAGATGGAATGGGG - Intergenic
1098066539 12:66623683-66623705 CTGAGCCTACAGAAGAAATGAGG - Intronic
1101347080 12:103896004-103896026 CTGAGCACAGAGATGGTAGGTGG - Intergenic
1101731716 12:107432265-107432287 CTGAGGACACTGATGGAATTGGG + Intronic
1104102050 12:125622030-125622052 CTGAGCCCACTGCTGCCATGTGG - Intronic
1106068397 13:26381188-26381210 CTGAGCCCACATTTTGAATTGGG + Intronic
1106610613 13:31276081-31276103 CTGATCACACAGATGAAAGGGGG - Intronic
1107110872 13:36696649-36696671 GTGAGCTCAGACATGGAATGTGG + Exonic
1107241913 13:38245871-38245893 CTGACCTGACAGATGGATTGGGG - Intergenic
1110441073 13:75525617-75525639 CTGAGCGCACAGGTGGGCTGCGG + Intronic
1113435768 13:110289883-110289905 CAGATCCCAGAGACGGAATGAGG + Intronic
1115220484 14:31053454-31053476 CAGAGGCCAGAGAAGGAATGGGG + Intronic
1118982724 14:70729729-70729751 CTGAGCCCACAGGTGGAAAGGGG - Exonic
1119719358 14:76880808-76880830 CTGAGCAGAAAGATGGGATGAGG + Intergenic
1120062131 14:79996572-79996594 CTGAGTAGACAAATGGAATGGGG - Intergenic
1121476615 14:94213753-94213775 CAGAGCCTCTAGATGGAATGTGG + Intronic
1121595766 14:95160984-95161006 CTGAGCCCAAAGAAGGAAGGTGG + Intergenic
1122578709 14:102757811-102757833 CTGAGCTCACGGCTGGACTGAGG - Intergenic
1123072259 14:105647595-105647617 CTGAGTGCACAGATGGGAGGAGG - Intergenic
1125672972 15:41486695-41486717 CAGAGCTCACAGATGGAATTAGG + Intergenic
1130642668 15:85693195-85693217 CTGGGCACCCAGATGGCATGTGG - Intronic
1131023120 15:89116531-89116553 CTGAGCATACAGAGGGCATGAGG - Intronic
1132585144 16:702896-702918 CTGAGCCAAGAGAGGGAAGGGGG + Intronic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1134234933 16:12458196-12458218 CTGGGCTCACAGATGGAACGTGG - Intronic
1134770103 16:16800777-16800799 CTGTGCCCATAGGTGGAAGGAGG + Intergenic
1135326037 16:21526465-21526487 CTGAGCCCCCAGATGGCACCTGG - Intergenic
1136086717 16:27890501-27890523 CTGTGGCCACAGTGGGAATGAGG + Intronic
1136417564 16:30113130-30113152 TGGAGCCCAGAGAGGGAATGTGG - Intronic
1138225668 16:55292295-55292317 CTGAGCTCACAGCTTGAGTGGGG + Intergenic
1140588212 16:76319803-76319825 CTAAGCCCACAGAGGGAGTATGG + Intronic
1142039075 16:87881190-87881212 CTGAGCCCCCAGATGGCACCTGG - Intergenic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142239831 16:88940178-88940200 CTCAGCCCACAGGGTGAATGAGG + Exonic
1142888284 17:2927041-2927063 TAGAGCCTACAGAGGGAATGCGG - Intronic
1144321184 17:14121894-14121916 CTGAGCCCAGAGAGGGAAGCTGG + Intronic
1145868562 17:28256102-28256124 AGGAGCCCACAGATGAGATGGGG - Intergenic
1147758412 17:42782641-42782663 TGGAGCCCACAGATGGGGTGGGG - Intronic
1149115221 17:53085956-53085978 CTGAGCAAGCACATGGAATGTGG + Intergenic
1149242765 17:54669602-54669624 CTGAGGCCACATATGTACTGAGG - Intergenic
1149849656 17:60027083-60027105 CTGAGGCCACAGCTGGGCTGGGG - Intergenic
1149860512 17:60119441-60119463 CTGAGGCCACAGCTGGGCTGGGG + Intergenic
1151354718 17:73551493-73551515 CTGACACCAGAGATGGAAGGAGG - Intronic
1151887652 17:76932615-76932637 CCGAGCACGCAGAAGGAATGGGG - Intronic
1152316892 17:79586198-79586220 CTGAGGCCCCACCTGGAATGGGG - Intergenic
1152848361 17:82616375-82616397 CTGAGCCCACAGGAGAAATAAGG + Intronic
1155392413 18:25350743-25350765 CTGAGCCCCTAGGTGGAGTGAGG - Intronic
1157802069 18:50628733-50628755 CAGAGCCCACAGGAGGAATGTGG - Intronic
1158941789 18:62411565-62411587 CTGAGCCTCCAGAAGGAGTGTGG - Intergenic
1161100054 19:2416978-2417000 TTTTGCCCCCAGATGGAATGGGG - Intronic
1161583237 19:5091993-5092015 CTAAGCCCACACATGGGAAGGGG - Intronic
1163708827 19:18833105-18833127 CTGCGACCACAGATGGGAGGTGG - Intronic
1165539805 19:36483435-36483457 CTGAGCCCAGAGATGGAAGAGGG + Intronic
1166188635 19:41160145-41160167 ATCAGCCCACAGATGGCAGGAGG - Intergenic
1167180741 19:47901535-47901557 CAGAGCCTCCAGAGGGAATGTGG + Intergenic
1167288016 19:48609810-48609832 CTGAGCACACTGAGGGAAAGTGG + Intronic
1167672329 19:50860363-50860385 CTGAGGACACAGATAGGATGGGG + Exonic
1168474717 19:56667534-56667556 CTGAGCCCACACATAACATGAGG - Intronic
925896523 2:8476539-8476561 CTGTGCCAACAGCAGGAATGAGG + Intergenic
927202141 2:20584435-20584457 CTGAACCTGCACATGGAATGGGG + Intronic
927460333 2:23293133-23293155 CTGAGCCCTCAGCTGGGATTAGG - Intergenic
932355248 2:71063020-71063042 CAGGGCCCAATGATGGAATGGGG + Intergenic
932746163 2:74335338-74335360 TTGAGGCCACAGAGGAAATGTGG + Intronic
933112150 2:78416441-78416463 CTGAGCTCACACATGGAACAGGG + Intergenic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
936062093 2:109301594-109301616 CTGAGCCCACAGAGGCCCTGGGG - Intronic
938709603 2:133964841-133964863 TTGAGGACACAGATTGAATGAGG + Intergenic
940659695 2:156531574-156531596 CTGAGGCCACAGATGTCGTGTGG + Intronic
940695613 2:156973692-156973714 CTGATCCCACTTTTGGAATGTGG - Intergenic
943503290 2:188719359-188719381 CTGAGTCCACAGTTGGCATCTGG - Intergenic
945153830 2:206816650-206816672 CTGAGGTCGCAGATGGAATTTGG - Intergenic
945252980 2:207779825-207779847 CTGAGGCCCCAGATAGCATGGGG + Intergenic
945483865 2:210371162-210371184 AGGAGTCCACAGTTGGAATGTGG + Intergenic
946819883 2:223618716-223618738 CAAATCCCACAGCTGGAATGTGG + Intergenic
948301442 2:236910008-236910030 CTTGGCCTACAGGTGGAATGGGG + Intergenic
948615831 2:239198266-239198288 CTGTGCCCACAGTTGGCAGGTGG - Intronic
948834006 2:240615592-240615614 TTGAGCCCATAGATGGAGTGTGG - Intronic
948966004 2:241381003-241381025 CTTACCCCCCTGATGGAATGTGG + Intronic
1168758323 20:331114-331136 CTGAGCTCCAAGAAGGAATGCGG - Intergenic
1169276536 20:4236888-4236910 CTGAGCCTCCAGAGGAAATGCGG + Intronic
1169421826 20:5466570-5466592 TGGACCCCACAGTTGGAATGTGG - Intergenic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1170775151 20:19368613-19368635 CAGAGACTGCAGATGGAATGGGG - Intronic
1173823036 20:46030832-46030854 CTCAGCCCCCAGGAGGAATGAGG - Intronic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174175293 20:48640791-48640813 GTGGGCACACAGATGGAAGGAGG + Intronic
1181393930 22:22604644-22604666 CTGAGTCCACAGCTGGGAAGGGG - Intergenic
1182528650 22:30938068-30938090 GTGGGCCCACAGCTGGAAGGGGG - Exonic
1183148953 22:36021974-36021996 ATGAGCAGACAGATGGAGTGAGG - Intronic
1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG + Intronic
1185180303 22:49356279-49356301 CTGAGGTCTCAGATGGAAAGGGG - Intergenic
1185349314 22:50326431-50326453 CTATGCCCAGAGATGGGATGCGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
952531332 3:34265194-34265216 CTGAGCACAGAGCTGGAATTTGG + Intergenic
954451204 3:50572645-50572667 CTGGGCCCAGAGATGGCAGGAGG - Intronic
954914328 3:54135927-54135949 TTGAGGCCACAGATGGAAGAAGG + Intronic
955039467 3:55301153-55301175 ATGAGCCCAAAGGTGGAATTTGG - Intergenic
955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG + Intronic
956578199 3:70779518-70779540 CAGAGCCAACAGATGAAATAAGG + Intergenic
956623517 3:71244933-71244955 CAGAGCCCTCAGATGAAGTGAGG + Intronic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960134978 3:114095664-114095686 CTGAGACCACAAATAGAAAGAGG - Intergenic
960205133 3:114887647-114887669 GTGAGCCTTCAGAGGGAATGTGG + Intronic
967248150 3:187509483-187509505 TTGAGGCTACAGATAGAATGGGG + Intergenic
967838449 3:193984085-193984107 CAGAGCCTTCAGAGGGAATGTGG + Intergenic
968205316 3:196794600-196794622 CTTAGCCCACAGGTGGCATAGGG + Intronic
968546687 4:1202556-1202578 CTGAGCCCACAGAAGCCGTGGGG - Intronic
968744825 4:2354145-2354167 CTGAGCCCACACATGGCCTGGGG - Intronic
969633434 4:8351599-8351621 CTGAGCACACAGAGGGGCTGTGG - Intergenic
970249802 4:14102323-14102345 CTTAGCCCAGAGATGGCACGTGG - Intergenic
971374730 4:26047859-26047881 ATGAGATCACAGAGGGAATGAGG + Intergenic
972169942 4:36333762-36333784 CCGTGCCCACAGAAGGAGTGTGG + Intronic
972711777 4:41604210-41604232 CTGTGCCTACAAATGGAAAGGGG - Intronic
975349931 4:73333818-73333840 GTGAGGCCACAGATGGCATTTGG - Intergenic
978372755 4:108045792-108045814 CTGAGGTCACAGCTGGCATGCGG - Intergenic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
983660491 4:170126558-170126580 CTGAGCCATCAGATGAACTGGGG + Intergenic
985135958 4:186786330-186786352 CGGTGCCCACATATGAAATGTGG + Intergenic
985720183 5:1484840-1484862 CTGAGCCCACAGCAGGAAGGGGG - Intronic
986526470 5:8683890-8683912 CTGATTCCACAGGTTGAATGAGG - Intergenic
987084671 5:14457517-14457539 CTGAGCCCACAGAGAGAAGCTGG + Intronic
987345128 5:16972233-16972255 CTTTGCCCACAGATGAACTGAGG + Intergenic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
988201379 5:28074377-28074399 ATGAGCCCACAGAGTGAATCTGG - Intergenic
990302053 5:54459137-54459159 CAGAGCCAGCAGATGAAATGCGG - Intergenic
991654837 5:68893738-68893760 CTGACCACACAGATTGAGTGAGG - Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
992369455 5:76127769-76127791 CTCAGCCAACAGTTGGCATGGGG + Intronic
992508640 5:77412077-77412099 CTGAGCAAACAGATGGGATGGGG - Intronic
992803548 5:80315079-80315101 CTGAGGCCACAGATCAACTGAGG - Intergenic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
997631063 5:135369310-135369332 ATGAGCCCACAGGGGGAATGAGG + Intronic
998532429 5:142898353-142898375 CTCAGGCAACAGAGGGAATGTGG - Intronic
999245626 5:150153064-150153086 AGGAGCCCAGAGATGGGATGTGG + Intronic
999703352 5:154248810-154248832 CTTAGGCCACTGAGGGAATGAGG + Intronic
1000082509 5:157861293-157861315 AAGATCCCAGAGATGGAATGTGG + Intergenic
1003810002 6:9768557-9768579 CAGAGTCCAGAGATGGAATTAGG - Intronic
1008108036 6:47461416-47461438 CTGAGCAGTCAGATGAAATGAGG - Intergenic
1008124816 6:47656246-47656268 CTGAGCCTAAAGATGAAATTTGG - Intergenic
1012208581 6:96492073-96492095 CTGAGCTTACAGATGGTATATGG - Intergenic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1013193208 6:107821591-107821613 CTGAGCCCTCAGATTTTATGTGG - Intronic
1015891922 6:137978047-137978069 CAGACCTCACAGATGGAATGAGG + Intergenic
1019079783 6:169422422-169422444 CTCAGCCAGCAGGTGGAATGGGG + Intergenic
1020740264 7:12007124-12007146 CTGAACCTACAGATAGAAGGTGG + Intergenic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1022725146 7:32974518-32974540 ATGTGCCCACAGATGTAATGGGG - Intronic
1024301929 7:47893466-47893488 CTGAGCCCACAGGCGGGAAGCGG + Intronic
1024480833 7:49860849-49860871 GTGAGGCCACAGAAGGAAGGTGG + Intronic
1025048455 7:55713327-55713349 ATGTGCCCACAGATGTAATGGGG + Intergenic
1031340037 7:120588633-120588655 CTTAGCCCACAGATGTCAGGAGG - Intronic
1031663711 7:124459162-124459184 CTGAGCCTCCACATGGACTGTGG + Intergenic
1031743726 7:125468170-125468192 CTGGTCCCGCAGAAGGAATGGGG - Intergenic
1032255438 7:130293414-130293436 CTGATTTCACAGATGAAATGGGG - Intronic
1033297122 7:140150124-140150146 TTGAGCCCAGAGATGGAAAATGG + Intronic
1034891247 7:154841213-154841235 CTGAGCCCACAGCTAGACTGTGG - Intronic
1035030847 7:155857892-155857914 TTGAGCCCAAAGCTGGATTGGGG + Intergenic
1036638568 8:10567880-10567902 CAGACACCACAGAGGGAATGGGG - Intergenic
1039080467 8:33728867-33728889 TTGATCCCAAAGCTGGAATGTGG + Intergenic
1039463239 8:37763079-37763101 CTGTGCCCACGGATGGTAAGGGG + Intronic
1040575730 8:48649569-48649591 CTGAGCCCACAGCTGGCCTCCGG - Intergenic
1045385526 8:101667960-101667982 CTGGGCCACCAGATGGAAAGGGG + Exonic
1047348710 8:124053186-124053208 CTGAGCCCACAGAGAGCATTTGG - Intronic
1047874661 8:129122785-129122807 CTGAGCTCACAGCTGGAGTGAGG + Intergenic
1048154825 8:131936627-131936649 CTGAGCCCAAGGAGGGAGTGTGG - Intronic
1048474788 8:134733445-134733467 TTGAGGCCAGAGATGGAATGGGG + Intergenic
1048843075 8:138581881-138581903 TTGATCCCACAGAAGGAATCAGG - Intergenic
1049504367 8:142987783-142987805 CACACCCCACACATGGAATGTGG + Intergenic
1051681779 9:19614761-19614783 CTGAGACCACAGGGGGAATCAGG + Intronic
1051820992 9:21168086-21168108 CTGAGTCCTTAAATGGAATGAGG + Intergenic
1051822853 9:21189008-21189030 CTGAGTCCTTAAATGGAATGAGG + Intergenic
1051824408 9:21203605-21203627 CTGAGTCCTTAAATGGAATGAGG + Intergenic
1051824745 9:21208570-21208592 CTGAGTCCTTAAATGGAATGAGG + Intronic
1051897267 9:22000577-22000599 CTCAGAACTCAGATGGAATGAGG + Intronic
1052742925 9:32411124-32411146 TTGAGCCCAAAGCTGGAATGGGG + Intronic
1054955505 9:70905123-70905145 CTGAGCCTACAAATGCAATGTGG + Intronic
1056070818 9:82984918-82984940 CTGTGCCCACAGATGTGTTGTGG + Intronic
1056662904 9:88557839-88557861 TTGAGCATACAGTTGGAATGAGG + Intronic
1058133021 9:101274849-101274871 CTGAACCCACAGAAGGAACATGG - Intronic
1058814185 9:108668511-108668533 CTGAGGACAAAGATGTAATGGGG + Intergenic
1059309836 9:113380713-113380735 CAGAGCCCACAGATGTTAGGTGG - Intergenic
1060556185 9:124508209-124508231 CTGGGCCCAGAGATTGGATGGGG - Intergenic
1061589971 9:131591906-131591928 CTGAGCTCAAAGCTGGAATGCGG + Intronic
1061648767 9:132028807-132028829 CTGATCCCACAGATTGGAGGTGG - Intronic
1062044421 9:134418466-134418488 CTGGGCCCACAGAGGGACAGAGG - Intronic
1185894813 X:3848434-3848456 CTGAGCCTTCAGAGGGAGTGTGG + Intergenic
1185899931 X:3886859-3886881 CTGAGCCTTCAGAGGGAGTGTGG + Intergenic
1185905047 X:3925287-3925309 CTGAGCCTTCAGAGGGAGTGTGG + Intergenic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1187521795 X:20020693-20020715 CTGAGCCTACAGGTGGCAGGTGG - Intronic
1189141539 X:38612218-38612240 CTGAGCGCCCAGCAGGAATGTGG + Intronic
1189939687 X:46108678-46108700 CAGAGCCCTCAGAAGTAATGTGG + Intergenic
1190429170 X:50361761-50361783 CTCAGCCCACAGAAGGCAGGTGG + Intergenic
1191207358 X:57849165-57849187 CTGAGCCCACACAGGGTCTGGGG - Intergenic
1192837066 X:74811342-74811364 CATAGCCTACAGATGGAATGCGG - Intronic
1192953595 X:76044298-76044320 CTCAGGCCAGAGAGGGAATGAGG - Intergenic
1198958747 X:142161395-142161417 CAGAGCCCTCAGAAGGATTGAGG + Intergenic
1199943677 X:152648905-152648927 CTGAGACTCCAGATGCAATGTGG - Intronic
1201496324 Y:14594223-14594245 ATGATCCAACAGAAGGAATGAGG - Intronic
1201547272 Y:15179366-15179388 CTGAGCTTACAGAAAGAATGTGG - Intergenic