ID: 1170555519

View in Genome Browser
Species Human (GRCh38)
Location 20:17511978-17512000
Sequence CATTGTGACGAGTGGGATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170555519_1170555528 13 Left 1170555519 20:17511978-17512000 CCCTCATCCCACTCGTCACAATG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1170555528 20:17512014-17512036 TGGTGTGGATGATCTGCTGCAGG 0: 1
1: 0
2: 1
3: 20
4: 179
1170555519_1170555529 26 Left 1170555519 20:17511978-17512000 CCCTCATCCCACTCGTCACAATG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1170555529 20:17512027-17512049 CTGCTGCAGGATGCTGATATAGG 0: 1
1: 1
2: 2
3: 58
4: 292
1170555519_1170555526 -7 Left 1170555519 20:17511978-17512000 CCCTCATCCCACTCGTCACAATG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1170555526 20:17511994-17512016 CACAATGGATGCTGGAGGAGTGG 0: 1
1: 0
2: 1
3: 21
4: 231
1170555519_1170555527 -2 Left 1170555519 20:17511978-17512000 CCCTCATCCCACTCGTCACAATG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1170555527 20:17511999-17512021 TGGATGCTGGAGGAGTGGTGTGG 0: 1
1: 0
2: 6
3: 69
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170555519 Original CRISPR CATTGTGACGAGTGGGATGA GGG (reversed) Exonic
902912232 1:19608275-19608297 CCGTGTGACTGGTGGGATGAAGG + Intronic
906587449 1:46991810-46991832 CATTGTGATGCGTGGGAAGGAGG + Intergenic
907020327 1:51060494-51060516 CAGTGTGACGAGTGGGGTGGAGG - Intergenic
907350139 1:53822579-53822601 CATTGTTACCAATGGGATTAAGG - Intronic
907449965 1:54539607-54539629 CATGGTGATGAATGAGATGATGG + Intergenic
909556013 1:76955087-76955109 CATTGTGAAAAGCGGCATGAAGG + Intronic
911133415 1:94414500-94414522 CAGTGTGTAGAGTGGGCTGAAGG - Intergenic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
911858087 1:102907469-102907491 AATTGTTACGAGTGGTATGTAGG - Intronic
912941576 1:114049707-114049729 CTTTGTGATGAGTGTGGTGATGG + Intergenic
914446381 1:147753940-147753962 AATTGTGACAAGTGTCATGAAGG - Intergenic
915524275 1:156466618-156466640 CATTGGGGCGAGTGTGGTGAGGG - Exonic
916196304 1:162226535-162226557 AATTGTGATGAGTGCAATGAAGG + Intronic
917782339 1:178411720-178411742 CCGTGTGACTGGTGGGATGAAGG + Intronic
923219236 1:231878251-231878273 AATTGTGACAAGTGACATGAAGG + Intronic
923699300 1:236284468-236284490 CATTGTTAAGAGTGGTATGACGG + Intergenic
924443267 1:244104330-244104352 CAAGGTGACGAGTGGGGTGTGGG - Intergenic
1064562307 10:16605269-16605291 GATGGTGACGAGTGGTATGATGG - Intronic
1065480908 10:26193037-26193059 CATGGTGAGGAGTAGGATAAGGG + Intronic
1069471860 10:68699801-68699823 CATTGTGATGTGTGGGTGGATGG + Intergenic
1074796477 10:116950774-116950796 CATTGTAACGAATGGGAAGAAGG - Intronic
1075744968 10:124720707-124720729 CTTTGTGACTGCTGGGATGATGG + Intronic
1078523082 11:12078901-12078923 CATTTTGGGGAGTGGGATGGGGG - Intergenic
1079662362 11:23055033-23055055 GATGGTGAAGAGTGGGAGGAAGG - Intergenic
1079699906 11:23532365-23532387 CCTGGAGACCAGTGGGATGAGGG - Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1085878706 11:80439976-80439998 GATTGTGATGAGTGCAATGAAGG + Intergenic
1087998246 11:104839105-104839127 CATGGTGAAGAGTGGGATTCAGG - Intergenic
1088981634 11:114869929-114869951 CATAGTGCAGAGTGGGAGGAAGG + Intergenic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1092213276 12:6662309-6662331 CACTGTGACAAGTGAGATAATGG - Intronic
1094018656 12:25890975-25890997 CATTGTGGAGAATGGGATAATGG + Intergenic
1096666520 12:53169969-53169991 CATGGAGACGAGAGGGATGAAGG + Intronic
1097954937 12:65474660-65474682 CATTGTGGCGGCTGGGAGGAGGG - Intronic
1101506530 12:105351942-105351964 CAGTGTGACACATGGGATGAGGG + Intronic
1101634192 12:106523713-106523735 AATTGTTAAGAGTGGGATGAGGG + Intronic
1102820257 12:115902698-115902720 CATTGTGATAAGTGTTATGAGGG + Intergenic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1106970388 13:35133846-35133868 GAGTGTGAAGAATGGGATGATGG + Intronic
1109143578 13:58748315-58748337 GATTGTGGCGAGAAGGATGAGGG - Intergenic
1115728239 14:36240040-36240062 CATTGTGGGGAGTGAGTTGAGGG + Intergenic
1115756215 14:36528017-36528039 CTTTATGACCAGTTGGATGAGGG - Intergenic
1118461066 14:65987501-65987523 CATTGCAAAGAGTGGGAGGAGGG + Intronic
1123064943 14:105613594-105613616 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123069144 14:105633047-105633069 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123074244 14:105659237-105659259 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123088241 14:105728820-105728842 CCTGGTGAGGAGTGGGATGCAGG - Intergenic
1123094200 14:105758190-105758212 CCTGGTGAGGAGTGGGATGCCGG - Intergenic
1124911559 15:33926361-33926383 CCTTGTGAGGATTGGGATCACGG + Intronic
1129700950 15:77768497-77768519 CATTGTGAGGAGAGCCATGAAGG + Intronic
1131063997 15:89421652-89421674 CCTTGTGGGGAGTGGGCTGAGGG + Intergenic
1131978520 15:97971534-97971556 CATGGTGAAGAGTGGAACGAAGG + Exonic
1133896818 16:9937584-9937606 CATAGTGAAGAATGTGATGAGGG + Intronic
1135030914 16:19037831-19037853 ACTTGTGAGCAGTGGGATGAAGG - Intronic
1135515797 16:23132446-23132468 CATTGTGACGAGTGTATAGATGG + Intronic
1138154163 16:54686998-54687020 CATAGTGACTAGTGGGATCCAGG + Intergenic
1141501574 16:84448453-84448475 CCTTGTGCAGAGTGGGGTGATGG + Intronic
1143119355 17:4597396-4597418 CATGGGGGCGAGTGGGATGTCGG + Intronic
1143245872 17:5485736-5485758 CATGGTGACTAGTGAGAGGAAGG - Intronic
1146599920 17:34205372-34205394 CAGTGTGCCGAGGGGAATGAGGG - Intergenic
1151434572 17:74086976-74086998 CATTGGGAAGAGGGGGATGCTGG - Intergenic
1152640130 17:81445833-81445855 CATTGGGAGGACTGGGAAGAGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155925110 18:31647714-31647736 CATTGTGGGGAGTGGTATTAGGG + Intronic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1166122667 19:40694770-40694792 CATTGAGACCTGAGGGATGAGGG - Intronic
930277339 2:49327918-49327940 CATTGTTAGGGGTGGGAGGAAGG + Intergenic
932558048 2:72842898-72842920 AACTGGGATGAGTGGGATGAAGG - Intergenic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
935201593 2:100861421-100861443 AATTGTGATGGGTGGGATGTCGG + Intronic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
941012179 2:160313041-160313063 CGCTGTGCTGAGTGGGATGAAGG + Intronic
1169659547 20:7963245-7963267 CATTGGGTCAAGTGGCATGAAGG + Intergenic
1170555519 20:17511978-17512000 CATTGTGACGAGTGGGATGAGGG - Exonic
1171444421 20:25193762-25193784 CAGTGTGATGAGTGCTATGAAGG + Intergenic
1173683400 20:44904249-44904271 CATTGTGACGAACGGGGTCATGG + Intronic
1175368720 20:58472223-58472245 GATTATGACAAGGGGGATGACGG + Intronic
1176971844 21:15275631-15275653 CATTGTGACGGTTGTGAGGAAGG + Intergenic
1178554608 21:33577985-33578007 CATTGTGACTAATGGCATCAGGG - Exonic
1184897146 22:47416557-47416579 CTTTGTGATGAGTGAGATTAAGG + Intergenic
949177987 3:1089995-1090017 CATCGTGGCGGGTGGGAGGAGGG - Intergenic
950624802 3:14237352-14237374 CATTGAGAAGAGTGGTATTAGGG - Intergenic
951465499 3:22996835-22996857 CATTGTCATGAATGGGATGCAGG + Intergenic
952836268 3:37605058-37605080 GATTGTTACGAGTGCTATGAGGG + Intronic
954132075 3:48566018-48566040 CTGTGTGGGGAGTGGGATGATGG - Intronic
954671093 3:52291771-52291793 CAGTGTGACAGGTGGGATGGGGG - Exonic
955070421 3:55568221-55568243 AATTGTGATGAGTGGTATGTGGG + Intronic
956880693 3:73508118-73508140 TATTGTGAAGAGTGGGAACAGGG - Intronic
957521065 3:81319196-81319218 CATTGTGTTGAGAGGGATGCAGG - Intergenic
959486735 3:106935296-106935318 GATTGTGATGAGTGTTATGAAGG - Intergenic
961302000 3:125928161-125928183 CTTTGTGAAGAGTGGGTTGACGG + Intergenic
961886470 3:130099664-130099686 CTTTGTGAAGAGTGGGTTGATGG - Intronic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
966622672 3:181982822-181982844 CATTGTGCTGAGTGGGATGTTGG + Intergenic
969462467 4:7335998-7336020 CTTTGTGACTTGGGGGATGATGG + Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970284535 4:14495485-14495507 TATTGTGATGAGTGGCCTGAAGG + Intergenic
972836639 4:42878536-42878558 GATTCTGACGTGTGAGATGAAGG - Intergenic
973809845 4:54558827-54558849 CAATGTGACGAGTGTCATGGTGG - Intergenic
976708934 4:88048276-88048298 AATTTTTAGGAGTGGGATGAGGG - Intronic
980765091 4:137291744-137291766 CATTCTGAATAGTGGGGTGAAGG - Intergenic
982596993 4:157398500-157398522 CATTTTGATGAGTGGGAAGAAGG + Intergenic
984212184 4:176863453-176863475 AAGTGTGAAGGGTGGGATGAGGG + Intergenic
984641032 4:182164350-182164372 CAATGTGATGAGTGGGATTGAGG - Intronic
988928822 5:36015638-36015660 CCTTGGGACGATTGGGATGCTGG + Intergenic
989290852 5:39763528-39763550 GAGAGTGAAGAGTGGGATGAGGG - Intergenic
990691381 5:58368025-58368047 CAGTGTGAATAATGGGATGATGG + Intergenic
991479300 5:67059927-67059949 CATTTTGAAGAGTGGGATTCGGG - Intronic
992208252 5:74452154-74452176 CATTGTCACGAGTGGTAACAAGG + Intergenic
995852693 5:116562720-116562742 CCGTGTGACTGGTGGGATGAAGG + Intronic
996776566 5:127138735-127138757 CATTATGACCAGTTGGTTGATGG - Intergenic
997667286 5:135641821-135641843 CATGGTGATGAAGGGGATGATGG - Intergenic
998490506 5:142542363-142542385 AACTGTGACGAGAGGGAGGAAGG - Intergenic
999294049 5:150446929-150446951 CCGTGTGACTGGTGGGATGAAGG - Exonic
1001450192 5:171818694-171818716 CATAGTGATGAGTGGTAGGATGG + Intergenic
1003409260 6:5848985-5849007 CATTGTGATCAGTGTCATGAAGG - Intergenic
1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG + Intergenic
1006834292 6:36987352-36987374 CATTATCAGGAGTGGGAAGAGGG - Intergenic
1011642984 6:89432958-89432980 CCTTCTGAAGAGTGGGAGGAAGG - Intergenic
1016846355 6:148571855-148571877 GATTGGGATGTGTGGGATGAAGG + Intergenic
1018936682 6:168278368-168278390 CATTGAGAAGAGTGGAATCAGGG - Intergenic
1022596815 7:31720442-31720464 TCCTGTGTCGAGTGGGATGAGGG + Intergenic
1023885369 7:44350071-44350093 CATTGTGAGGGGTGGGGAGAAGG - Intergenic
1024921170 7:54556423-54556445 CATTGGGAGGAGGGAGATGAGGG + Intronic
1027339443 7:77190478-77190500 GATGCTGATGAGTGGGATGAAGG + Intronic
1030874375 7:114795050-114795072 CAAAGTGAGGAGTGTGATGATGG + Intergenic
1031271560 7:119656413-119656435 CCTTGTGACAAGTGGTAAGATGG + Intergenic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1039329394 8:36520410-36520432 AATTCTGACTAGTGGGAGGAGGG + Intergenic
1041306719 8:56469373-56469395 CATTGTGATGATGGGAATGAGGG - Intergenic
1041556776 8:59165943-59165965 CTTTGTGACCAGTTGGATGAAGG + Intergenic
1043057503 8:75457879-75457901 TATTGTGAGGAGTGAGATGATGG + Intronic
1046072922 8:109280522-109280544 GATTGTGAGGAGTGGGAGGATGG + Intronic
1048854734 8:138676787-138676809 TATTGGGCTGAGTGGGATGATGG - Intronic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049610230 8:143551743-143551765 CAGTGGGGAGAGTGGGATGAGGG - Intergenic
1050151859 9:2624655-2624677 CATTGTGAGAAGTGGGTTGGTGG + Intronic
1050821382 9:9884226-9884248 CATTGTGAAGAATGGAATGAGGG + Intronic
1051768981 9:20555699-20555721 CAGTGTGCCTAGTGAGATGAGGG - Intronic
1052755683 9:32538509-32538531 AATTGTGATGAGTGGTCTGAAGG + Intergenic
1054925490 9:70584763-70584785 CATTGTGAGGTGTAAGATGAAGG - Intronic
1055065862 9:72117672-72117694 CATTTTAACCAGTGAGATGAGGG - Intronic
1055197557 9:73614940-73614962 CAATGAGACGAGAGAGATGATGG - Intergenic
1055899323 9:81216919-81216941 CATGGTGAGGAGTGTGGTGAGGG - Intergenic
1057709850 9:97429720-97429742 CATTGTGTCAAGTGTGATAACGG - Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1061903904 9:133686746-133686768 CACTGTGACGATTGGGATTAGGG - Intronic
1189073911 X:37895637-37895659 CATTGAGAAAAGTGGGATGGTGG + Intronic
1189781484 X:44518189-44518211 CACTGTGATCAGTGGAATGATGG - Intergenic
1193554300 X:82933548-82933570 CATTGGCAGGTGTGGGATGAAGG + Intergenic
1194497899 X:94639570-94639592 CATTGTCCTGAGTGGGCTGAGGG + Intergenic
1199443833 X:147898264-147898286 CATTTTGAGTAATGGGATGAAGG + Intergenic