ID: 1170559250

View in Genome Browser
Species Human (GRCh38)
Location 20:17541950-17541972
Sequence TCTCAAGGTAACCTGAGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170559248_1170559250 3 Left 1170559248 20:17541924-17541946 CCAAATTCTCTCAGAGTACATTA 0: 1
1: 0
2: 0
3: 16
4: 209
Right 1170559250 20:17541950-17541972 TCTCAAGGTAACCTGAGTTTTGG 0: 1
1: 0
2: 1
3: 6
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170559250 Original CRISPR TCTCAAGGTAACCTGAGTTT TGG Intronic
901125437 1:6925481-6925503 TCTTGAGGTAACCTGTGTTGAGG + Intronic
903536258 1:24068236-24068258 TGTCAAGGTAATCTGGTTTTTGG + Exonic
905089616 1:35418436-35418458 TCTCAAGATAAACTGACTGTTGG + Exonic
913653531 1:120940437-120940459 GCTCATGATCACCTGAGTTTAGG - Intergenic
914167567 1:145188593-145188615 GCTCATGGTCACCTGAGTTTAGG + Intergenic
914519219 1:148400559-148400581 GCTCATGATCACCTGAGTTTAGG - Intergenic
914643715 1:149634596-149634618 GCTCATGATCACCTGAGTTTAGG - Intergenic
914682507 1:149948848-149948870 TCACAAGCTAAGATGAGTTTTGG - Intronic
916313599 1:163423561-163423583 TCTCAAGGTCAACTGATTTAGGG - Intergenic
916692053 1:167199675-167199697 ATTAAAGGAAACCTGAGTTTGGG + Intergenic
918248349 1:182680261-182680283 TCTCAAGGTAGCCAGACCTTGGG - Intronic
919229419 1:194754393-194754415 TCTAAATGTAACCAGTGTTTAGG + Intergenic
920813188 1:209306142-209306164 ATTCAGGGTAACCTGATTTTAGG + Intergenic
922116702 1:222619672-222619694 TCTCCAGGTAACCTGTTTTGAGG - Intronic
923404484 1:233646499-233646521 TCTCAAGGTGGCCGCAGTTTTGG + Intronic
1063549626 10:7018268-7018290 TATCTAGCTAACCTGTGTTTGGG - Intergenic
1065026547 10:21544298-21544320 TCTCAAAGGAACATGAGATTGGG - Intronic
1068024169 10:51622226-51622248 TTTCCAGGTGACCTGAGTCTTGG - Intronic
1069785220 10:70983543-70983565 TATCAAGGTAAACTGTGTTCAGG + Intergenic
1071776489 10:88794226-88794248 TCTGAGGGTGAGCTGAGTTTGGG - Intergenic
1075929177 10:126280203-126280225 ACTGAAGGTCACATGAGTTTTGG + Intronic
1078841352 11:15078072-15078094 TTTCATGATAACCTGAGATTAGG - Intronic
1080061250 11:27959147-27959169 CCTCCATGTAACCTCAGTTTTGG - Intergenic
1083049163 11:59761649-59761671 TCTCAGGGTAGCCTGCTTTTTGG + Intronic
1083792368 11:64994319-64994341 TTTCTAGGTCACCTGAGTTTGGG - Intronic
1087992964 11:104768955-104768977 TCTCATGGTCACCTTGGTTTTGG + Intergenic
1091592182 12:1849691-1849713 CCTGTAGGTAACCTGACTTTTGG + Intronic
1091757549 12:3064553-3064575 TCTCAAGGTAACTTGGATGTTGG - Intergenic
1098794051 12:74865871-74865893 TCTCATGGTAACTTAAATTTAGG + Intergenic
1100608034 12:96167790-96167812 TCTAAATGAAACCTGTGTTTAGG - Intergenic
1101727598 12:107401081-107401103 TCTCATGGAAACCTGGGGTTTGG + Intronic
1103218697 12:119224949-119224971 TCTCAAGGGAACCAGAGTTTGGG - Intergenic
1103252230 12:119510009-119510031 CCTGAAGGCCACCTGAGTTTTGG + Intronic
1104773193 12:131377389-131377411 TCCCATGTCAACCTGAGTTTTGG + Intergenic
1107689745 13:42941391-42941413 TCTCAAAGTAATTTCAGTTTTGG + Intronic
1111244854 13:85523576-85523598 GCTCAGGGTAAGCTGTGTTTTGG + Intergenic
1111266838 13:85826573-85826595 CCTAAAGGCAACATGAGTTTGGG - Intergenic
1114842503 14:26281820-26281842 TGTCAGCTTAACCTGAGTTTGGG + Intergenic
1116735801 14:48689493-48689515 TCTCAAGGAAACATTATTTTAGG + Intergenic
1120794777 14:88620364-88620386 TCTCTTAGTAACCTCAGTTTGGG - Exonic
1122190913 14:100042955-100042977 TCTCAAGGCCACCTGAGATATGG + Intronic
1124078928 15:26473330-26473352 GCTCAGGGAAACCTGAGTATGGG - Intergenic
1124403563 15:29373332-29373354 AACCAAGGGAACCTGAGTTTAGG + Intronic
1124475066 15:30026082-30026104 TCTCAATGAAACCTGAATGTGGG - Intergenic
1124945472 15:34261609-34261631 TCTTAAAGTCACCTAAGTTTAGG + Intronic
1125366724 15:38925351-38925373 TCTCAAAGTCATCTGAGTGTTGG + Intergenic
1126354447 15:47780374-47780396 TCTCAAGATAACAGGATTTTAGG - Intergenic
1127262985 15:57339271-57339293 TCACAATGCAACCTGAGATTTGG - Intergenic
1127321384 15:57849926-57849948 GCTCAAGGTACTCTGAGTATGGG + Intergenic
1130406638 15:83608810-83608832 CCTCAGGGTAACCTGGGTTCTGG + Intronic
1130862079 15:87900147-87900169 TCTCAAGGAAGTCTGAGGTTGGG + Intronic
1133874963 16:9725296-9725318 AGTCAAGGTAAGATGAGTTTGGG + Intergenic
1133894866 16:9916995-9917017 TCTCATGGTAGACTCAGTTTCGG - Intronic
1134862000 16:17568583-17568605 TCTCAAGGCAAAATGAGTTTCGG + Intergenic
1135967743 16:27050042-27050064 TCTCAATGAAACCTCAGCTTTGG + Intergenic
1142017498 16:87758073-87758095 TTTCAAGGTCAAGTGAGTTTGGG + Intronic
1146164902 17:30580220-30580242 ACTCAAGGCAAAATGAGTTTTGG - Intergenic
1146180787 17:30697073-30697095 TCTAAAGGGATCCTGTGTTTGGG - Intergenic
1147174593 17:38646228-38646250 TCTCAAATTAATCTGAGTGTAGG - Intergenic
1150591641 17:66567749-66567771 TGCCAAGGTAACCTGCGTTTGGG + Intronic
1157991231 18:52498905-52498927 TCTCAAGGTAACAGGAGATAAGG - Intronic
1159529491 18:69637278-69637300 TTTCACGGTCACGTGAGTTTAGG + Intronic
1162977793 19:14218462-14218484 TCTAAAGGGATCCTGTGTTTGGG + Intergenic
927308548 2:21601904-21601926 TCTCAAGGAGACCAGAGTCTAGG + Intergenic
928997922 2:37315516-37315538 TCTCTAGGTACCCTGTGTTCTGG - Intronic
930513327 2:52374091-52374113 ACCCAAGGTAACCTCAGTTATGG + Intergenic
935042231 2:99443728-99443750 TTTGAATGTAACCTGAATTTTGG - Intronic
936604234 2:113933193-113933215 TTTTAAGGTAACATGTGTTTAGG - Intronic
939582111 2:143962580-143962602 TGTCAAGGTATCCAGAGTCTGGG + Intronic
940749745 2:157612270-157612292 TCTCAATGTAGCCTCTGTTTTGG - Intronic
944304708 2:198165978-198166000 TCTCCAGGAAACCTGTGTTATGG - Intronic
947479212 2:230482203-230482225 TATCTTGGTAACCTGAGATTAGG - Intronic
1170559250 20:17541950-17541972 TCTCAAGGTAACCTGAGTTTTGG + Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1172872968 20:38147252-38147274 TCTCGAGGTAATGGGAGTTTAGG - Intronic
1173036443 20:39415739-39415761 TCTCAAGGAAACATTAATTTTGG + Intergenic
1176452216 21:6873692-6873714 TTTCAAGGTAATCTGTCTTTGGG + Intergenic
1176830388 21:13738741-13738763 TTTCAAGGTAATCTGTCTTTGGG + Intergenic
1177959784 21:27648974-27648996 TTTCAAAGCAACCTGAGTTGCGG - Intergenic
1178725286 21:35046066-35046088 TTTCAAGGGAACCCAAGTTTGGG + Intronic
1180879564 22:19194252-19194274 TCTCAAGATCACCTGAGGTCAGG + Intronic
1181297934 22:21856872-21856894 CATCAAGGTAACCCGAGTTTAGG - Intronic
1183855731 22:40632894-40632916 TCTCAAGGAAATTAGAGTTTTGG - Intronic
1184438221 22:44493435-44493457 TCTCTTGGGGACCTGAGTTTGGG - Exonic
949395619 3:3612009-3612031 TCTCAGAGTAAACTGACTTTGGG + Intergenic
949834553 3:8253916-8253938 TGTCAAGGTAACCAGAGAATTGG - Intergenic
951253020 3:20416240-20416262 TCTCTAGGTAACCTGGGCATTGG - Intergenic
951400631 3:22228396-22228418 TCTCCAGGTTTCCTCAGTTTGGG - Intronic
956777992 3:72581801-72581823 TCTCCAAGAAACCTCAGTTTCGG + Intergenic
957911507 3:86624789-86624811 TCTCAAGGTAGCTGGAGGTTGGG - Intergenic
961771390 3:129252702-129252724 TCTCAAGGAAAGCTGGGTTGAGG - Intronic
963971405 3:151433458-151433480 TCTCAAAGAAACCTTGGTTTAGG - Exonic
964177427 3:153840929-153840951 TCTCAAGCTAGCCTCAGTTATGG - Intergenic
966702351 3:182868739-182868761 TCACAAGCTTACCTGACTTTAGG + Intronic
974324782 4:60399273-60399295 TCTCTGGGTACCCTGTGTTTTGG - Intergenic
975606120 4:76156111-76156133 TCCCATGGGAACCTGAGCTTGGG - Intergenic
979217504 4:118183079-118183101 TCTCCTGCTAACCTGAATTTTGG + Intronic
981663912 4:147199894-147199916 ACTTAAGGTAACATGAGTATGGG + Intergenic
983542583 4:168928895-168928917 TCTTAAAGTCACCTGACTTTGGG + Intronic
983822568 4:172213862-172213884 TATCTAGGTGACCTTAGTTTTGG - Intronic
984599258 4:181707175-181707197 TTTCCAGGTAACCTGATTTTGGG - Intergenic
987157241 5:15101516-15101538 TCTCAAGGTCACATGACTTGTGG + Intergenic
989949395 5:50279976-50279998 TCACCAGGTAACTTCAGTTTGGG + Intergenic
990889186 5:60630600-60630622 TTTCATGGCAACCAGAGTTTTGG - Intronic
991055337 5:62314144-62314166 TCTCTAGATATCCTGGGTTTGGG + Intronic
993583570 5:89695107-89695129 TCTATAGGTCACTTGAGTTTTGG - Intergenic
998044031 5:138971980-138972002 CCTGAAGGAGACCTGAGTTTTGG - Intronic
1002022133 5:176370422-176370444 TCTCAGAGGCACCTGAGTTTAGG - Intronic
1002845349 6:940120-940142 TCTCAATGGGACCTGAGTGTGGG - Intergenic
1004156534 6:13173445-13173467 TCTCCAGTTTGCCTGAGTTTAGG - Intronic
1004692969 6:18008752-18008774 CCTCAAGTTATCCTGACTTTAGG - Intergenic
1005875211 6:30006260-30006282 TCTCAATGTTCCCTGAGTCTTGG - Intergenic
1008716375 6:54294948-54294970 TCTCAAGTTCCCTTGAGTTTAGG + Intergenic
1010368188 6:75077110-75077132 ATTCAAGGTAACCTGAGTGGGGG - Intergenic
1011258276 6:85446335-85446357 TAACAATGTAACCTGAGTATTGG + Intergenic
1011546225 6:88484077-88484099 TCTCATGGTAACTTGTTTTTAGG - Intergenic
1012847731 6:104411650-104411672 TTTCAAGGTAGCGTTAGTTTGGG + Intergenic
1014284188 6:119477947-119477969 TCTCATGGTTACCTGAATCTTGG + Intergenic
1014648662 6:124007897-124007919 TCTCATGGTTCCTTGAGTTTTGG + Intronic
1014852258 6:126356217-126356239 ACTCAAGATAACATGAGTTAGGG - Intergenic
1016352262 6:143180849-143180871 CCTCAAGGGAACCTTAATTTAGG + Intronic
1016803904 6:148193591-148193613 TTACAAGGGAAGCTGAGTTTTGG + Intergenic
1020697283 7:11429114-11429136 CCTCAATGTAACCTGAGTAGAGG + Exonic
1022748874 7:33202855-33202877 TCTCCAGGTAAGTTAAGTTTTGG - Intronic
1023298981 7:38747904-38747926 TCTGAAGGTAAGCTGAAGTTAGG + Intronic
1024576148 7:50766204-50766226 TCACAAGGGACCCTGAGTATAGG - Intronic
1035112957 7:156499518-156499540 TCTCATGCAAACTTGAGTTTGGG - Intergenic
1036925072 8:12896485-12896507 TCTCAAGCTGACCTGAGAGTGGG + Intergenic
1038985210 8:32801496-32801518 TCTCTAGATAACCTCAGTCTAGG + Intergenic
1041632563 8:60104407-60104429 TCTGAAGGACAGCTGAGTTTTGG + Intergenic
1042251590 8:66761284-66761306 TCTTAAGTGAACCTGATTTTTGG + Intronic
1043326195 8:79054882-79054904 GAGCAAGGTAACCTGAGTCTGGG - Intergenic
1043716017 8:83487890-83487912 ACTCTAGGTTACCTGAGGTTGGG + Intergenic
1045160283 8:99533955-99533977 TCTCAAAATAACCTTTGTTTTGG + Intronic
1048497240 8:134945518-134945540 TTTCAAGGAAATCTGAGTATTGG - Intergenic
1048687475 8:136919942-136919964 TCTCAAGTGTAGCTGAGTTTGGG + Intergenic
1049311278 8:141935144-141935166 TCTCAAGGAAACCTGACTGGGGG + Intergenic
1050707740 9:8422365-8422387 TTTCAAGTTAACATGACTTTAGG + Intronic
1051143911 9:14006964-14006986 CCCCAAGGCAACCTGAGGTTTGG - Intergenic
1052344619 9:27396764-27396786 CCTCAAGGCAGCCTGATTTTTGG + Intronic
1055891430 9:81128386-81128408 TCTCTAGCTACCCTGAGTATTGG + Intergenic
1056430765 9:86525956-86525978 TCTGGAAGCAACCTGAGTTTTGG + Intergenic
1056520335 9:87395401-87395423 TCTAAAGGAAAGCTGAGTTGGGG - Intergenic
1056658718 9:88529341-88529363 TCTAAAGGTGACATGAGTGTGGG - Intergenic
1058861811 9:109123809-109123831 TCTCAAGGTCATATGATTTTAGG + Intergenic
1061367574 9:130180536-130180558 TTTCTAGGTAACTTGAGATTGGG + Intronic
1203516965 Un_GL000213v1:10823-10845 TTTCAAGGTAATCTGTCTTTGGG - Intergenic
1191865649 X:65701635-65701657 TCTTATGGTAAGCTAAGTTTGGG + Intronic
1199555629 X:149105544-149105566 TCCCATGGGAACTTGAGTTTTGG - Intergenic
1200307938 X:155047565-155047587 TCTCATGGTTACAGGAGTTTGGG + Intronic