ID: 1170559422

View in Genome Browser
Species Human (GRCh38)
Location 20:17544037-17544059
Sequence TGCCACGGAGTTGGCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170559422_1170559428 6 Left 1170559422 20:17544037-17544059 CCCCAGAAGCCAACTCCGTGGCA No data
Right 1170559428 20:17544066-17544088 TGAGTACAAGTAATGTATTTTGG 0: 1
1: 1
2: 6
3: 63
4: 408
1170559422_1170559429 19 Left 1170559422 20:17544037-17544059 CCCCAGAAGCCAACTCCGTGGCA No data
Right 1170559429 20:17544079-17544101 TGTATTTTGGACATGATCCCAGG 0: 1
1: 0
2: 7
3: 37
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170559422 Original CRISPR TGCCACGGAGTTGGCTTCTG GGG (reversed) Intronic
No off target data available for this crispr