ID: 1170560385

View in Genome Browser
Species Human (GRCh38)
Location 20:17552160-17552182
Sequence GCATCTGGTAATTTTAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170560385 Original CRISPR GCATCTGGTAATTTTAGACA GGG Intronic
908030393 1:59993036-59993058 GCCTCTGGAAATATAAGACATGG + Intronic
909407471 1:75307630-75307652 GAATCTGGTGATTTTTGAGAGGG + Intronic
909929575 1:81480380-81480402 TCATCTGGTAATGCTAGACTAGG - Intronic
910584693 1:88866341-88866363 GCATTTGCTTACTTTAGACAGGG - Intronic
912138955 1:106697589-106697611 GGATCTGATAGTTTTAGAAATGG + Intergenic
913248470 1:116891462-116891484 GAATCTGGTAATTTATGAAATGG + Intergenic
913659284 1:120992379-120992401 GCCTCAGGTAATTCTTGACATGG - Intergenic
914010647 1:143775503-143775525 GCCTCAGGTAATTCTTGACATGG - Intergenic
914167179 1:145185612-145185634 GCCTCAGGTAATTCTTGACATGG + Intergenic
914649270 1:149684160-149684182 GCCTCAGGTAATTCTTGACATGG - Intergenic
915055845 1:153129514-153129536 TCATCTTATAATTTTAGAGAAGG - Intergenic
916832903 1:168511307-168511329 GCAACTGGTAATTATAAACAGGG - Intergenic
918704510 1:187643419-187643441 GCTTCTGGTAACTTTGGAGATGG + Intergenic
921773338 1:219069529-219069551 GCAACTAGTAAATTTTGACAAGG + Intergenic
923452536 1:234132770-234132792 GGTTCTGGTAATTTTATTCATGG + Intronic
924228240 1:241940910-241940932 GAATCTTGTAATTTTAGAATTGG - Intergenic
1062956888 10:1546413-1546435 GCAGGTGGTAATTTTAGAGCTGG - Intronic
1069506804 10:69005783-69005805 GCATCTGGAAATGTTTGAGAAGG + Exonic
1072444105 10:95483135-95483157 GCATCTGTAGATTTTAGAAAAGG - Intronic
1074203702 10:111261867-111261889 GCATTTGGTGAATTTAGGCAAGG - Intergenic
1074621667 10:115131693-115131715 AAATCTGGTAGTTTTATACAAGG + Intronic
1074879755 10:117646770-117646792 GCAGCTGGTAATGTAAAACAGGG - Intergenic
1075317398 10:121464032-121464054 GCATTTGTTCATTTTAGACGGGG - Intergenic
1079013936 11:16853053-16853075 GCATCTTTTAGTTTTAGAGATGG + Intronic
1079680397 11:23289622-23289644 ACATCTCATAATTTTAGTCATGG - Intergenic
1084503498 11:69550629-69550651 GCATCTGATAATTTGTGATATGG - Intergenic
1084621735 11:70275818-70275840 AGATCTGGTAATTTAAGAAAAGG + Intronic
1085382113 11:76129291-76129313 GCATCTGGTGATTCCAGAAAAGG + Intronic
1086607878 11:88718967-88718989 GCATGAGGCAATTTTAGATAGGG - Intronic
1091195061 11:133723835-133723857 GAATCTGGTAATTTAGGAAATGG + Intergenic
1092808517 12:12250178-12250200 GCATTTTGTAAATTTAGGCAAGG - Intronic
1094251072 12:28362138-28362160 GCATCTGCCAATTCTTGACATGG - Intronic
1096011763 12:48223180-48223202 GCTTCTGATATTTATAGACAAGG - Intergenic
1098699008 12:73598790-73598812 TCATCTGGGAATTTAAGAGAAGG - Intergenic
1099340650 12:81428959-81428981 TCATCTGGTAAGTTTAGTCATGG + Intronic
1103192853 12:119017317-119017339 GCATCCGGGAATTTTAGAACTGG - Intronic
1106021220 13:25917370-25917392 GCATCTGGTAATTTCAGCTGCGG - Intronic
1106425245 13:29622663-29622685 GCTTCTGGTAATGATAGACTAGG + Intergenic
1109551761 13:63912279-63912301 ACATCTGGTAATTTCTGCCATGG - Intergenic
1109974220 13:69809548-69809570 GCTTAAGGGAATTTTAGACATGG + Intronic
1114197649 14:20493213-20493235 CCATCTGGTTTTTTTGGACATGG + Intergenic
1115251405 14:31352357-31352379 GCATCAGGTAATTAAACACACGG + Intronic
1116901875 14:50369287-50369309 GCAGCTGTTCACTTTAGACAAGG + Intronic
1120598407 14:86470248-86470270 GCATGTGTTACTTTGAGACAAGG - Intergenic
1124356226 15:28996760-28996782 GCATGTGGTAAGCTTGGACAGGG + Intronic
1124414663 15:29465156-29465178 GCATCTTGTCACTTTGGACATGG - Intronic
1124467926 15:29956110-29956132 GCATTTTTTAATTTTAGAAATGG - Intronic
1130262303 15:82365334-82365356 GCATATGGTAATCTCAGGCACGG + Intergenic
1130278925 15:82503673-82503695 GCATATGGTAATCTCAGGCACGG - Intergenic
1130316761 15:82802892-82802914 GCATGTGGTAAGGTTAGCCAGGG - Intronic
1133808588 16:9144217-9144239 GCAAGTGGTAATTTTATAAAAGG + Intergenic
1133849264 16:9486406-9486428 GCATCTGGTAGGTTGAGACGAGG + Intergenic
1135255167 16:20935929-20935951 GCAGCTGCTCAGTTTAGACAAGG - Intronic
1140649761 16:77074998-77075020 ACATATGGCCATTTTAGACAAGG + Intergenic
1149065975 17:52479610-52479632 GCCTCTGATAATTTTTGACCAGG - Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153651334 18:7242921-7242943 GCATATGGGAATTTTTGAGATGG - Intergenic
1154015104 18:10609325-10609347 GCATCTGGGAACTGTAAACAAGG - Intergenic
1154037407 18:10816775-10816797 ACATCTGGAAATATCAGACATGG - Intronic
1154190415 18:12226319-12226341 GCATCTGGGAACTGTAAACAAGG + Intergenic
1157134797 18:45043602-45043624 GGCTCTGGTAGTTTTAAACATGG - Intronic
1159724630 18:71941314-71941336 GCATCTGGTAATTTGAGTCATGG + Intergenic
1164094716 19:21997035-21997057 ATGTCTGGTAATTCTAGACAAGG + Intronic
1164114290 19:22202513-22202535 ATGTCTGGTAATTCTAGACAAGG + Intergenic
1202650281 1_KI270706v1_random:173516-173538 GCATCTGGTGATCTTAGGCCTGG + Intergenic
1202650600 1_KI270707v1_random:461-483 GCATCTGGTGATCTTAGGCCTGG + Intergenic
926179493 2:10628720-10628742 GATTCTGGTCATTTAAGACATGG - Intronic
931753335 2:65349935-65349957 GCATCTGGCTATTTAAAACAAGG + Intronic
935899178 2:107772415-107772437 ACAGCTTGTAAATTTAGACAGGG - Intergenic
940524627 2:154797486-154797508 GTATCTGATGATTTTAGCCATGG + Intronic
941148097 2:161878851-161878873 CAATCTTGAAATTTTAGACAGGG - Intronic
942758546 2:179370597-179370619 GCATTAGGTAATTTAAGAGAAGG - Intergenic
943561750 2:189472277-189472299 GCAGCTTGTAATTTTAAACAGGG + Intronic
946290670 2:218742483-218742505 GAATCATGTAATTTTAGAGATGG + Intronic
948117160 2:235501981-235502003 GCATCTGTTATTTTTATTCAGGG + Intronic
1170445226 20:16419579-16419601 GCATCTGGGAAATTTATACTTGG - Intronic
1170560385 20:17552160-17552182 GCATCTGGTAATTTTAGACAGGG + Intronic
1176601531 21:8799035-8799057 GCATCTGGTGATCTTAGGCCTGG - Intergenic
1177910414 21:27024319-27024341 TCATCTGGAAATTAAAGACATGG + Intergenic
1180343818 22:11690586-11690608 GCATCTGGTGATCTTAGGCCTGG - Intergenic
959239236 3:103767395-103767417 GAATCTGCTGATTGTAGACATGG + Intergenic
960383214 3:116989738-116989760 GCATCAGGTAATTTTCAACACGG + Intronic
961383652 3:126511814-126511836 GCAAATGGAAATTTTATACAAGG - Intronic
967430851 3:189383529-189383551 GCATCTTGTAATTTTTTGCAGGG + Intergenic
970298141 4:14653452-14653474 GCTACCGGTAATTTTAGAAAGGG + Intergenic
970594745 4:17589961-17589983 GTATCTGGTTATTTCAGCCAAGG + Intronic
970844229 4:20516920-20516942 GCATCTGTTACTTTTTAACATGG + Intronic
972142483 4:35977602-35977624 GCTTCTGGTAATTTTTGCAAGGG - Intronic
977442510 4:97087124-97087146 GCATTTTATAATTTTAAACAAGG + Intergenic
979492550 4:121344903-121344925 AAATCTGGTAATTTTAAACTGGG + Intronic
980842882 4:138287730-138287752 GCATCTGGCTTTTTTAGCCATGG - Intergenic
984143273 4:176029857-176029879 GCACCTGGTAGTTTTTGAAATGG + Intergenic
986815553 5:11405815-11405837 GCATCAGCCAACTTTAGACATGG + Intronic
987768470 5:22267772-22267794 GGATCTGGTAATGTTTGAGAGGG - Intronic
993177349 5:84503665-84503687 GTATCTAGTAAAGTTAGACAGGG - Intergenic
998991727 5:147824457-147824479 GAATCCTGTAATTTCAGACAGGG - Intergenic
1001996802 5:176168102-176168124 GTATTTGGTAATTTTGGCCAAGG - Intergenic
1006616101 6:35328113-35328135 GCATTTGGTAAGATTAGCCAAGG - Intergenic
1009803752 6:68575419-68575441 GTAGCTGGTAACTATAGACATGG - Intergenic
1015152380 6:130054348-130054370 GCCTCTGGAAAGTTAAGACAAGG + Intronic
1016687853 6:146901393-146901415 GAATGTTGTAATTTTAGATAAGG - Intergenic
1017862251 6:158409652-158409674 GCAGCTGTGAATTATAGACAGGG + Intronic
1020421854 7:8015751-8015773 GACTTTGGTAATTTTAGAGATGG - Intronic
1021188679 7:17595134-17595156 GCATCTGGCTATTTCAGATAAGG + Intergenic
1022562818 7:31367452-31367474 TCATCTGGTCATTTTGGACATGG - Intergenic
1028428349 7:90716872-90716894 GCACCTTGAAATTTGAGACATGG - Intronic
1028566594 7:92239635-92239657 GAATCTGGTAATTAGAGAAAAGG + Intronic
1028738778 7:94248601-94248623 GGATCTGGGAATGTTAGAGAAGG - Intergenic
1031920982 7:127600383-127600405 GTATCTGGGAATTTTAGGTAAGG + Exonic
1034594592 7:152177681-152177703 GCATCTTCTAATCTGAGACATGG - Exonic
1037023419 8:14002356-14002378 GGATCTGGTATTTGTAAACATGG - Intergenic
1040737246 8:50523036-50523058 TCATCTTGTAATTTTATATATGG + Intronic
1045817680 8:106295745-106295767 GCACCTGGTACTTTTTCACATGG - Intronic
1048290287 8:133176115-133176137 CCATCTGGGATTTTTGGACATGG - Intergenic
1050094570 9:2050676-2050698 GCTACTGGTAATTTTTGAGAAGG - Intronic
1050146966 9:2579037-2579059 GCTTCTGGTAATGGTAGACCAGG + Intergenic
1050450191 9:5772418-5772440 TCACATGGTAATTTTAGCCATGG + Intronic
1051002460 9:12301315-12301337 GCATCTAGTAATTCCAGAAAAGG + Intergenic
1051792781 9:20826711-20826733 GCCTCTGGCAATTTAATACATGG + Intronic
1052407787 9:28084338-28084360 TCACATGGTAATTTGAGACAGGG + Intronic
1055624531 9:78161568-78161590 GCATCTGGTAAATATAAACAGGG + Intergenic
1056197158 9:84239884-84239906 CCAACAGGTAATTTAAGACATGG + Intergenic
1203749613 Un_GL000218v1:66108-66130 GCATCTGGTGATCTTAGGCCTGG + Intergenic
1187665401 X:21603334-21603356 GCATCTAGTAGTTTTCTACATGG - Intronic
1193824988 X:86213784-86213806 GCAGCTGGAATTTTAAGACAGGG - Intronic
1196177054 X:112650290-112650312 GCATTTGGTCATCTTAGAAAAGG + Intronic
1197499218 X:127223080-127223102 AGATCTGATAATTTTATACATGG + Intergenic
1201947795 Y:19530771-19530793 GCATCAGATAATTCAAGACATGG + Intergenic
1202080708 Y:21081260-21081282 GCATCTGATGATTTTATAAAGGG - Intergenic