ID: 1170561244

View in Genome Browser
Species Human (GRCh38)
Location 20:17560405-17560427
Sequence CTGGTGCAGCAGATCACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170561244_1170561252 10 Left 1170561244 20:17560405-17560427 CCTGGTGTGATCTGCTGCACCAG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1170561252 20:17560438-17560460 GAGAATTCCCAAGGGAACTTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1170561244_1170561251 9 Left 1170561244 20:17560405-17560427 CCTGGTGTGATCTGCTGCACCAG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1170561251 20:17560437-17560459 TGAGAATTCCCAAGGGAACTTGG 0: 1
1: 0
2: 2
3: 11
4: 185
1170561244_1170561255 25 Left 1170561244 20:17560405-17560427 CCTGGTGTGATCTGCTGCACCAG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1170561255 20:17560453-17560475 AACTTGGGCCAAGTTTATCTTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1170561244_1170561249 2 Left 1170561244 20:17560405-17560427 CCTGGTGTGATCTGCTGCACCAG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1170561249 20:17560430-17560452 AGGATCCTGAGAATTCCCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 150
1170561244_1170561248 1 Left 1170561244 20:17560405-17560427 CCTGGTGTGATCTGCTGCACCAG 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1170561248 20:17560429-17560451 TAGGATCCTGAGAATTCCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170561244 Original CRISPR CTGGTGCAGCAGATCACACC AGG (reversed) Intronic
900251608 1:1673391-1673413 CAGGTGCAGCAGCTCACGCCTGG + Intronic
900261969 1:1735927-1735949 CAGGTACAGCAGCTCACGCCTGG + Intronic
900646263 1:3710089-3710111 CTGGTGCAGCTGACCAGCCCGGG - Intronic
901028761 1:6293887-6293909 CTGCTACTGCAGAACACACCTGG - Intronic
901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG + Exonic
903605241 1:24570746-24570768 CTGGTGATGCAGACCACACATGG + Intronic
904203526 1:28837371-28837393 CAGGTGCAGTGGCTCACACCAGG + Intronic
904687967 1:32274335-32274357 CTGTGGCTGCAGCTCACACCCGG + Exonic
906385950 1:45368718-45368740 CAGGTGCAGTGGCTCACACCTGG - Intronic
908134188 1:61113314-61113336 CAGGTGCAGGGGATCACACCTGG + Intronic
908678684 1:66634455-66634477 CTGGTACAGCAGCTGACACGTGG + Intronic
908784364 1:67720338-67720360 CTGGTCCAGCAGAGCACAGAAGG - Intronic
910672890 1:89790748-89790770 CTGGTGCAGTAGACCAGAGCTGG + Intronic
913220512 1:116656689-116656711 CTGGAGCAGCAGATCACCTGAGG + Intronic
915319518 1:155048603-155048625 GTGTTGCATCAGATTACACCGGG - Intronic
915668847 1:157470258-157470280 CTGGAGCAGCAGAACAGAACAGG - Intergenic
917754199 1:178083100-178083122 CTGTAGCAGCAGATGACTCCAGG + Intergenic
918295068 1:183148910-183148932 CTGATACAGGAGATCAGACCTGG + Intergenic
920317137 1:205084739-205084761 CAGGTGCAGGCTATCACACCTGG + Intergenic
922124161 1:222706569-222706591 CAGATGCAAAAGATCACACCCGG + Intronic
1064800283 10:19063000-19063022 CAGGTGCACAAGACCACACCTGG - Intronic
1071369700 10:84938811-84938833 CTTGTGCAGCACTGCACACCAGG - Intergenic
1071423706 10:85527528-85527550 CTGGACCAGCAGAACCCACCAGG - Intergenic
1073077082 10:100830854-100830876 CTGATGCAGCAGAACAATCCTGG - Intergenic
1073321971 10:102621051-102621073 CTGGAGCAGCAGAGCCCACTTGG - Intronic
1074387981 10:113032235-113032257 ATGGTACAGCAGCTCACACACGG - Intronic
1075039263 10:119094792-119094814 CGGGTGCAGTGGCTCACACCTGG - Intergenic
1075818550 10:125285369-125285391 CTGGTGCAGCATCTCTCACTGGG - Intergenic
1076009260 10:126974252-126974274 CTGGTGCAGCATCTCACCCTGGG - Intronic
1076311821 10:129513508-129513530 CTGGAGCAGCAGCTCAGAGCAGG + Intronic
1077463293 11:2721679-2721701 CTGATGCTGCAGATCACGCCAGG + Intronic
1077662724 11:4084005-4084027 CTTGTGCAGGAGATCCCTCCTGG - Intronic
1078420761 11:11210255-11210277 CTGCTGCAGCAGAGCATGCCAGG - Intergenic
1080270847 11:30449368-30449390 CAGGTGCAGTGGCTCACACCTGG + Intronic
1083577482 11:63802659-63802681 CGGGTGCAGTGGCTCACACCTGG - Intergenic
1085671786 11:78473021-78473043 CTGGTGCAGGCCACCACACCCGG - Intronic
1093457023 12:19374676-19374698 CAGGTGCAGTGGCTCACACCTGG + Intronic
1093702967 12:22243753-22243775 CGGGTGCAGTGGCTCACACCTGG + Intronic
1094085720 12:26589510-26589532 CAGGTGCAGTGGCTCACACCTGG + Intronic
1096212785 12:49779195-49779217 CTGGTGCAGTGGCTCACGCCCGG - Intergenic
1096414777 12:51403637-51403659 CTGGAGCAGCAGATAACGGCAGG + Intronic
1096438407 12:51616356-51616378 CAGGTGCAGTGGCTCACACCTGG + Intronic
1096575506 12:52550184-52550206 CTGCTGCAGCAGCTCCCACTTGG + Exonic
1096579037 12:52572608-52572630 CTGCTGCAGCAGCTCCCACTTGG + Exonic
1096785371 12:54014333-54014355 CTGGTGCCGCTGCTCACAGCAGG - Intronic
1104456121 12:128913752-128913774 CTGGTGCAGCAGGAAAAACCTGG + Intronic
1105505077 13:21002829-21002851 CAGGTGCAGGCAATCACACCTGG + Intronic
1105542712 13:21328511-21328533 CCTGTGCAGCAGACCTCACCAGG + Intergenic
1106527233 13:30551968-30551990 CAGGTGCAGTGGCTCACACCTGG - Intronic
1106695804 13:32171451-32171473 CAGGTGCACAACATCACACCTGG + Intronic
1107797929 13:44073632-44073654 CAGGTGCAATAGCTCACACCTGG + Intergenic
1108465159 13:50707791-50707813 CTGGTCCAGCAGACCAGACTAGG + Intronic
1109421287 13:62115682-62115704 CTGGAGAATCAGATCACACCTGG - Intergenic
1109559613 13:64029738-64029760 CGGGAGAATCAGATCACACCTGG - Intergenic
1110617115 13:77553632-77553654 CTTGGGCAGCTGAGCACACCGGG - Intronic
1112155192 13:96809595-96809617 GAGGAGCAGCAGACCACACCTGG + Intronic
1112618187 13:101026957-101026979 CTGAGGCAGCAGATCACCTCAGG - Intergenic
1116746694 14:48829762-48829784 CAGGCACAGCAGCTCACACCTGG + Intergenic
1121540908 14:94725669-94725691 CTGGCGCAGTGGCTCACACCTGG - Intergenic
1121749907 14:96343121-96343143 CTGGTGCAGTTGAACACACTGGG + Exonic
1122633736 14:103120448-103120470 CAGGTGCACCCCATCACACCTGG + Intergenic
1123069776 14:105636976-105636998 CTGTTACATCACATCACACCAGG + Intergenic
1123945516 15:25236998-25237020 GTGGTGCTGCAGATCATCCCTGG + Intergenic
1125688443 15:41577882-41577904 CTGGTACATGAGATCATACCTGG - Exonic
1126850588 15:52794717-52794739 CTGCTGCAGAAGAACACCCCAGG - Intergenic
1128009708 15:64281326-64281348 TGGGTGCAGCAGCTCACACCTGG + Intronic
1129323878 15:74789454-74789476 CTGGTTCTGCAGAGGACACCAGG - Intronic
1132870056 16:2111955-2111977 CAGGTGCAGCCGTTCACCCCGGG - Intronic
1132908131 16:2294407-2294429 CGGGTGCAGTGGCTCACACCTGG + Intronic
1133078024 16:3295092-3295114 CTGGTTCTGCAAATCACTCCTGG - Intronic
1133185532 16:4094717-4094739 CAGGCACTGCAGATCACACCTGG + Intronic
1133601575 16:7344998-7345020 CTCGTGGAGAAGATCAAACCTGG + Intronic
1133999030 16:10768324-10768346 CAGGTGCAGTGGCTCACACCTGG + Exonic
1134710153 16:16323646-16323668 CAGGTGCAGCCGTTCACCCCGGG + Intergenic
1134717367 16:16363646-16363668 CAGGTGCAGCCGTTCACCCCGGG + Intergenic
1134760801 16:16713237-16713259 CCGGTGCAGTGGCTCACACCTGG - Intergenic
1134949450 16:18344999-18345021 CAGGTGCAGCCGTTCACCCCGGG - Intergenic
1134957385 16:18388513-18388535 CAGGTGCAGCCGTTCACCCCGGG - Intergenic
1134985257 16:18645936-18645958 CCGGTGCAGTGGCTCACACCTGG + Intergenic
1135684372 16:24486532-24486554 CAGGTGCAGTGGCTCACACCTGG + Intergenic
1135832460 16:25788134-25788156 CCGGTGCAGTGGCTCACACCTGG + Intronic
1135898522 16:26433019-26433041 ATGGTGCAGCCAATCACAACAGG - Intergenic
1137273747 16:46919800-46919822 CTGGTGCACGATATCTCACCTGG - Intronic
1140105516 16:71956132-71956154 CAGGTGCAGTGGCTCACACCTGG - Intronic
1140242531 16:73216414-73216436 CTGTTGCAGCAGATCACTGGTGG - Intergenic
1140563361 16:76010528-76010550 CAGGTGGAGCAGATGAGACCAGG + Intergenic
1141507264 16:84486100-84486122 CAGGTGCAGTGGCTCACACCTGG - Intronic
1141538258 16:84698869-84698891 CAGGCGCAGCGGCTCACACCCGG - Intergenic
1142015245 16:87742526-87742548 CTGATGGATCAGATCACAACTGG + Intronic
1142488202 17:260309-260331 CTGGTACAGCACGCCACACCTGG + Intronic
1142534280 17:603146-603168 CGGGTGCAGTGGCTCACACCTGG + Intronic
1142641213 17:1286884-1286906 CAGCTGGAGCAAATCACACCCGG - Intronic
1142744805 17:1950568-1950590 CCGGGGCAGCAGCTCACGCCTGG + Intronic
1142769461 17:2086133-2086155 CTGGGGCAGCAGACAACCCCAGG + Intronic
1142956430 17:3526199-3526221 CCGGCGCAGGAGCTCACACCTGG + Intronic
1145036523 17:19544594-19544616 CTGGTGAAGGCGAGCACACCTGG + Intronic
1146124642 17:30221779-30221801 CTGGTGCGGGAGATGACACACGG - Exonic
1147332267 17:39706016-39706038 CCGGGGTAGCAGCTCACACCAGG - Intronic
1147600805 17:41744111-41744133 CAGGTGCAGTGGCTCACACCTGG + Intergenic
1148050481 17:44767712-44767734 CTGGTGCAGCTGAGCCCAGCAGG - Intronic
1148395495 17:47304882-47304904 CAGGTGCAGTGGCTCACACCTGG - Intronic
1150557337 17:66266296-66266318 CAGGTGCAGTGGCTCACACCTGG - Intergenic
1151002046 17:70389188-70389210 CAGGTGCAGTGGCTCACACCTGG - Intergenic
1151862589 17:76776253-76776275 CTGGTGCGGTGGCTCACACCTGG - Intronic
1152599972 17:81257370-81257392 CCGGTACAGCAGCTCACACCTGG - Intronic
1152703260 17:81829957-81829979 GTGGAGCAGCAGGTGACACCTGG - Intronic
1152934544 17:83128430-83128452 CTGGTTCTGCAGACTACACCCGG + Intergenic
1153566887 18:6427777-6427799 CAGGCGCAGCAGCTCACACCTGG + Intergenic
1153944138 18:10003949-10003971 GAGGTGCTGCAGATCCCACCAGG - Intergenic
1154246582 18:12704445-12704467 CAGGTGCAGGAAACCACACCTGG - Intronic
1155000552 18:21681858-21681880 CAGGTGCAGTGGCTCACACCTGG + Intronic
1155063864 18:22252390-22252412 CAGGTGCATGATATCACACCTGG + Intergenic
1156367200 18:36440277-36440299 CTGCTGCAGAAGATGACAGCTGG - Intronic
1159899992 18:74036862-74036884 CTGGAACAGAATATCACACCTGG + Intergenic
1160156365 18:76436789-76436811 CAGGTGCAGTGGCTCACACCTGG + Intronic
1161033060 19:2068384-2068406 CTGGTGCGGTGGCTCACACCTGG - Intergenic
1161148588 19:2694762-2694784 CTCAGGGAGCAGATCACACCTGG - Intronic
1161154677 19:2726570-2726592 CTGGGGCAGCAGTTCCCACGGGG + Intronic
1161195969 19:2986979-2987001 CTGGTTCAGCAGGTGAGACCTGG - Exonic
1161579669 19:5073838-5073860 CAGGTGCAGTAGCTCACACCTGG + Intronic
1161705185 19:5817058-5817080 TGGGTGCAGTGGATCACACCTGG + Intergenic
1161936862 19:7377505-7377527 CAGGTGCAGCAGCTCACACCTGG + Intronic
1162069762 19:8146688-8146710 CAGGTGCAGTGGCTCACACCTGG + Intronic
1162896204 19:13765949-13765971 TCGGTGCAGCAGATCACTCTGGG - Exonic
1162942308 19:14018478-14018500 CAGGTGCAGCAGCTCATGCCTGG + Intergenic
1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG + Intronic
1166170742 19:41026139-41026161 CAGGTGCGGCAGGTCACTCCTGG + Intergenic
1166545161 19:43630046-43630068 CAGGTGCACAACATCACACCTGG + Intronic
1168108350 19:54178184-54178206 CGGGTGCGGCAGCTCACGCCTGG - Intronic
926017263 2:9464866-9464888 CAGGTGCAGTGGCTCACACCTGG - Intronic
928437078 2:31261663-31261685 CGGGAGCACCAGATCTCACCTGG + Exonic
928978890 2:37118029-37118051 CGGGTGCAGTGGAGCACACCTGG + Intronic
929864821 2:45709096-45709118 CTGGCGCTGCTGCTCACACCTGG + Intronic
930605717 2:53490975-53490997 CTGGTGCAGCATGACACAACAGG - Intergenic
931767344 2:65468485-65468507 CTGGGGCATCAGATCACAGAGGG + Intergenic
934694854 2:96392354-96392376 CAGGTGCAGTGGCTCACACCTGG + Intergenic
935125071 2:100215654-100215676 CTAGCGCAGCAGATCCCACCTGG + Intergenic
937260236 2:120580814-120580836 CTGCTGCAAGAGATAACACCCGG - Intergenic
938257012 2:129867211-129867233 CGGGTGCAGTGGCTCACACCTGG - Intergenic
939880910 2:147630308-147630330 CTGTTGCTACAAATCACACCAGG + Intergenic
940105640 2:150096796-150096818 AGGGTGCAGTAGCTCACACCTGG + Intergenic
941381689 2:164801021-164801043 TGGGTGCAGCAGCTCACATCTGG + Intronic
942144784 2:173016247-173016269 CTGGTGAAGCAGATGACATAGGG + Intronic
944405471 2:199379050-199379072 CATGTGTAGCAGCTCACACCAGG + Intronic
945476210 2:210285314-210285336 CTGAAGCAGCATATCACCCCTGG - Intergenic
946473349 2:219983301-219983323 CGGGTGCAGTGGCTCACACCTGG - Intergenic
947901166 2:233723484-233723506 CAGGTGCAGTGGCTCACACCTGG - Intronic
1170561244 20:17560405-17560427 CTGGTGCAGCAGATCACACCAGG - Intronic
1170894045 20:20398388-20398410 GTGGTCCAGCACACCACACCAGG - Intronic
1170927426 20:20738125-20738147 CGGGTGCAGTGGCTCACACCTGG - Intergenic
1172675417 20:36667066-36667088 CAGGTGCAGCAGATCACTTGAGG - Intronic
1172712057 20:36932691-36932713 CGGGTGCAGTGGCTCACACCTGG - Intronic
1172925999 20:38535859-38535881 CAGGTGCAGTAGCTCACACCTGG - Intronic
1173788584 20:45812909-45812931 CGGGTGCAGGAGAACACACCAGG + Intronic
1174237180 20:49103399-49103421 CTGAGGCAGCAGTTCCCACCAGG + Intergenic
1174331304 20:49820819-49820841 CTGGTGCGGTGGCTCACACCTGG - Intronic
1175813834 20:61873397-61873419 CTGGGGCAGCAGAGCAGGCCTGG - Intronic
1177609376 21:23425044-23425066 CGGCTGGAGCAGATCACACCTGG - Intergenic
1180822046 22:18836931-18836953 CTGGAGCAGCAGATCACCTGAGG + Intergenic
1181190930 22:21139115-21139137 CTGGAGCAGCAGATCACCTGAGG - Intergenic
1181208274 22:21271392-21271414 CTGGAGCAGCAGATCACCTGAGG + Intergenic
1181625283 22:24118784-24118806 ATGGGGCAGCAGTTCACATCAGG - Intronic
1183409957 22:37648998-37649020 CAGGCGCGGCAGCTCACACCTGG - Intronic
1184573617 22:45343676-45343698 CAGGTGCACCCCATCACACCTGG + Intergenic
1184789429 22:46690252-46690274 GTGGGGCAGCAGAACACCCCAGG + Intronic
1203218654 22_KI270731v1_random:24020-24042 CTGGAGCAGCAGATCACCTGAGG - Intergenic
1203272175 22_KI270734v1_random:62816-62838 CTGGAGCAGCAGATCACCTGAGG + Intergenic
949223305 3:1662199-1662221 CAGGTGCACAACATCACACCTGG - Intergenic
949954884 3:9259436-9259458 CTGGTGTTTCAGGTCACACCTGG - Intronic
950723844 3:14902974-14902996 CTGGTGCAGCTGTCCACAGCTGG - Intronic
952688612 3:36177431-36177453 CTGTTGCAGCAGCTCACAGGTGG - Intergenic
952845299 3:37683089-37683111 TTGGGGCAGCAGATCCCACAGGG - Intronic
953244156 3:41175637-41175659 CTGAGGCAGCCGTTCACACCAGG + Intergenic
955145941 3:56319692-56319714 CAGGTGCCGTAGCTCACACCTGG + Intronic
955356203 3:58235387-58235409 CAGTTGCAGCAGAACACTCCAGG - Intergenic
955557794 3:60156470-60156492 TGGGTGCAGCGGTTCACACCTGG + Intronic
955658891 3:61275684-61275706 CAGGTGCACAACATCACACCTGG + Intergenic
956792993 3:72694382-72694404 CTGCTGTAGGAGATCACCCCTGG - Intergenic
960701687 3:120445844-120445866 CTGCTGCAGCTGAGCGCACCTGG - Intronic
961537937 3:127581145-127581167 CTGGTGCCCCAGGCCACACCTGG - Intronic
964532523 3:157683795-157683817 CTGGAGCAGCAGATTAAATCAGG - Intergenic
965580020 3:170257938-170257960 CAGGTGCAGTGGCTCACACCTGG - Intronic
965611238 3:170546220-170546242 CTGGTGGAGAGGAGCACACCAGG + Intronic
966001652 3:174956150-174956172 CAGTTGCAGAAGATCACAACTGG + Intronic
968578273 4:1377940-1377962 CTGGTGCAGGAGATGGCACCTGG + Intronic
969516195 4:7649440-7649462 CTGCAGCTGCAGAGCACACCTGG - Intronic
970763008 4:19514514-19514536 TTGGTGTAGCAGATACCACCAGG + Intergenic
972679820 4:41294609-41294631 CTGGTGCAGCATAACTCAGCAGG + Intergenic
974463100 4:62215359-62215381 CGGGTGCAGTGGCTCACACCTGG - Intergenic
975610824 4:76201034-76201056 CAGTTGCATCAGATCACAACAGG - Intronic
976380330 4:84391416-84391438 CTGGTTCATGAGATTACACCGGG + Intergenic
978232634 4:106419282-106419304 CTGAGGCAGCAGATCACATGAGG + Intergenic
981432793 4:144681565-144681587 CAGGTGCAGGACACCACACCTGG + Intronic
982250850 4:153405009-153405031 CAGGTGCAATAGCTCACACCTGG - Intronic
983724722 4:170906493-170906515 CTGAGGCAGCAGATCACTTCAGG - Intergenic
984807353 4:183763870-183763892 CTGGCGCAGCGGCTCACGCCTGG - Intergenic
984955074 4:185037027-185037049 CTGGTGCCTCAGAGCACTCCAGG + Intergenic
985089814 4:186351317-186351339 CTGGTGCAGTGGCTCACATCTGG + Intergenic
985509544 5:305070-305092 CTGGAGCTGCAGCTCCCACCTGG - Intronic
985613902 5:907900-907922 CTGGGGCAGCAGGCCACATCAGG + Intronic
986486431 5:8242827-8242849 CTGGTCCAGAAAATGACACCTGG + Intergenic
986803453 5:11285146-11285168 CTGGGGCAGCAGATATAACCTGG - Intronic
987756669 5:22105553-22105575 CAGGTGCAGAACACCACACCTGG - Intronic
990370556 5:55114250-55114272 CAGCTGCAGCAGAAAACACCCGG + Exonic
990727548 5:58773601-58773623 TTTGTGCAGCAGTTCACACTGGG + Intronic
992892427 5:81215545-81215567 CGGGTGCAGTGGGTCACACCTGG - Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995328053 5:110914211-110914233 CAGGTGCAGTGGCTCACACCTGG - Intergenic
996948072 5:129094366-129094388 CCGGTGCTGCAGCTCACACAAGG - Intergenic
997232304 5:132253884-132253906 TTGGTTCAGCAGAACACACAGGG - Intronic
997309523 5:132868120-132868142 CAGGTGCAGGACACCACACCTGG + Intergenic
998378162 5:141705035-141705057 CTGGTGCAGCATCTCACTCAGGG + Intergenic
1003409295 6:5849312-5849334 CATGTGCAGCAGACCCCACCAGG - Intergenic
1003610595 6:7611319-7611341 CAGGTGTGGTAGATCACACCTGG - Exonic
1005659115 6:27976487-27976509 CAGGTGCAGTGGCTCACACCTGG + Intergenic
1007941533 6:45786033-45786055 CTGGGGCAGCACCTCACATCAGG - Intergenic
1011893851 6:92199851-92199873 CTGGTGCAGTGGCTCACACCTGG - Intergenic
1015371523 6:132459361-132459383 CTGGAGCACCAGTTCACTCCAGG - Exonic
1018743179 6:166745426-166745448 CGGGTGCAGTGGCTCACACCTGG - Intronic
1020927556 7:14351303-14351325 CTGGTGAATCAGGTCCCACCAGG - Intronic
1022046092 7:26623705-26623727 CAGGTGCAGTGGCTCACACCTGG - Intergenic
1022121986 7:27317318-27317340 CAGGTGCAGTGGCTCACACCTGG - Intergenic
1023374670 7:39544063-39544085 CTGGTGCAGAACAGAACACCTGG - Intergenic
1024270522 7:47638148-47638170 CTGGTGCAGTGGTTCACACCTGG - Intergenic
1025867729 7:65402160-65402182 CGGGTGCAGTGGCTCACACCTGG - Intergenic
1029664091 7:101983327-101983349 CTGGGGCTGGAGACCACACCTGG - Intronic
1030607979 7:111658781-111658803 CTGGAGCAGCTGCTTACACCTGG + Intergenic
1030824462 7:114138532-114138554 CAGGTGCATAAGACCACACCCGG + Intronic
1031290084 7:119923357-119923379 CTGGTGCAGTGGCTCACACCTGG - Intergenic
1032543567 7:132724217-132724239 CTCTTGCAGCAGATCACATGAGG - Intronic
1032793049 7:135256526-135256548 CGGGTGCAGTGGCTCACACCTGG + Intronic
1032850843 7:135793794-135793816 CTGCTGCAGCAGCTCAGCCCTGG + Intergenic
1035447078 7:158950427-158950449 CCCGTGCAGTATATCACACCTGG - Intronic
1035447087 7:158950488-158950510 CCCGTGCAGTATATCACACCTGG - Intronic
1035447096 7:158950549-158950571 CCCGTGCAGTATATCACACCTGG - Intronic
1035447105 7:158950610-158950632 CCCGTGCAGTATATCACACCTGG - Intronic
1035447113 7:158950671-158950693 CCGGTGCAGTATATCACACCTGG - Intronic
1035447131 7:158950793-158950815 CCGGTGCAGTATATCACACCTGG - Intronic
1035447140 7:158950854-158950876 CCGGTGCAGTATATCACACCTGG - Intronic
1035447149 7:158950915-158950937 CCGGTGCAGTATATCACACCTGG - Intronic
1035898326 8:3429883-3429905 ACTGTGCACCAGATCACACCAGG + Intronic
1036710418 8:11074960-11074982 ATGGGGCAGCAGACCAGACCAGG + Intronic
1037865898 8:22441623-22441645 CAGGTGCAGCAGAAAACGCCGGG - Intronic
1037956595 8:23065087-23065109 CTGGTGGAGCAGGTGACAGCAGG - Intronic
1038633129 8:29263965-29263987 CAGGTGCAGGGGCTCACACCTGG + Intergenic
1038785423 8:30610166-30610188 CAGGTGCAGTGGCTCACACCTGG + Intronic
1039586646 8:38712681-38712703 CCGGTGCTGCAGCCCACACCTGG - Intergenic
1039617329 8:38966496-38966518 CTGATGCAGCATGTAACACCGGG + Intronic
1040537557 8:48323191-48323213 GTGGTGCTGTAGATCAGACCAGG + Intergenic
1042891914 8:73621754-73621776 CTGATGCAGCAGATCAGGCTTGG - Intronic
1044835504 8:96291843-96291865 CTGGTGCTGCGTATCACACTAGG + Intronic
1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG + Intronic
1045268906 8:100644937-100644959 CAGGTGCAGTGGCTCACACCTGG - Intronic
1046291065 8:112162458-112162480 CAGGTGCAGTGGCTCACACCTGG + Intergenic
1046733059 8:117746614-117746636 CTGGAGCAGCAGATAATTCCTGG - Intergenic
1049640333 8:143712363-143712385 CTTGTGCAGCAGCTCAGAGCTGG + Intronic
1049642824 8:143723056-143723078 CAGGTGCAGCTGAGGACACCTGG - Intergenic
1050058511 9:1680381-1680403 CTAGTGCAGTAGATCATGCCGGG - Intergenic
1053115818 9:35501298-35501320 CGGGTGCAGTGGCTCACACCTGG + Intronic
1055890161 9:81115671-81115693 CTGGTGAAGCAGGTCCTACCTGG - Intergenic
1059258085 9:112948780-112948802 CTGGTGCTGCACATCCGACCTGG - Intergenic
1061328485 9:129878368-129878390 CTGATGCAGTAGATGACGCCCGG - Exonic
1186416325 X:9385961-9385983 CAGGTGCAGTGGCTCACACCTGG - Intergenic
1187791288 X:22952903-22952925 CTGGGGCAGCAGAGCAGACCAGG + Intergenic
1188029115 X:25244790-25244812 CCAGTGCATCAGATCACACCTGG - Intergenic
1190411381 X:50140331-50140353 CTAGGGCAGCAGAGCACAGCTGG - Intergenic
1192174297 X:68876140-68876162 ATGGTTCAGGAGAACACACCCGG + Intergenic
1196179105 X:112671100-112671122 CAGGAGCAGCAGAGCACAGCCGG + Exonic
1196772887 X:119312863-119312885 CAGGTGCACGAGACCACACCTGG - Intergenic
1200122446 X:153797574-153797596 CTGGGGCTTCAGGTCACACCCGG - Intronic
1201248576 Y:12032106-12032128 CTGGGGCAGCAGATCACTTGAGG + Intergenic