ID: 1170561567

View in Genome Browser
Species Human (GRCh38)
Location 20:17563085-17563107
Sequence CTCATCCCACAGATGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170561567_1170561573 1 Left 1170561567 20:17563085-17563107 CCTTACCCCATCTGTGGGATGAG 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1170561573 20:17563109-17563131 CCAGTGATAATATCTAACTGTGG 0: 1
1: 0
2: 1
3: 9
4: 118
1170561567_1170561574 14 Left 1170561567 20:17563085-17563107 CCTTACCCCATCTGTGGGATGAG 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1170561574 20:17563122-17563144 CTAACTGTGGCAGTCACTACTGG 0: 1
1: 0
2: 2
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170561567 Original CRISPR CTCATCCCACAGATGGGGTA AGG (reversed) Intronic
900322539 1:2092263-2092285 CTCTTCACACAGAGGGGGCAGGG - Intronic
902181636 1:14693618-14693640 CTCATCCCACAGACGGTTTATGG - Intronic
902459511 1:16562796-16562818 CTCTGCCCGCAGATGGGCTAAGG + Exonic
902880940 1:19371467-19371489 CTCAGCCCACAGCATGGGTAAGG + Intronic
903051464 1:20604360-20604382 CTCATGCGGCAGATGGGGCAAGG + Intronic
903152704 1:21423475-21423497 CTCTGCCCACAGATGGGCTGAGG + Intergenic
903160425 1:21484510-21484532 CTCTGCCCACAGATGGGCTGAGG - Exonic
903835084 1:26198444-26198466 CTCATCCCACCTATGGGGCAGGG + Intronic
904587119 1:31586698-31586720 CTCTGCCCACAGATGGGGAGAGG + Exonic
905237594 1:36560795-36560817 CTCTTGCCACACATGGGCTATGG - Intergenic
907243874 1:53094901-53094923 CACATCCCAGGGATGGGGTGGGG + Intronic
907754007 1:57292137-57292159 TTCATCCCACAGATGTAGAATGG + Intronic
908522329 1:64956375-64956397 CTCATCCCACTGAAGGGGCGTGG + Intronic
911158395 1:94657989-94658011 ATCAGCCCACAGGTGGGGGAGGG + Intergenic
912543437 1:110433942-110433964 CTCAGCCCACAGTGGGGGCAGGG + Intergenic
912559050 1:110537272-110537294 CTGAACCCACTGATGGGGTTGGG + Intergenic
912959378 1:114181546-114181568 CTGAGCCTACAGATGGGGGAGGG + Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
919966721 1:202534290-202534312 CTAATTCCAGAGCTGGGGTAAGG - Intronic
920278481 1:204826123-204826145 AGCATCACACAGATGGGGTGTGG - Intergenic
920563835 1:206958410-206958432 CTCTTCCCACAGGTGGAGGAAGG + Exonic
1062858912 10:794616-794638 CTCAGCCCAGAGGTGGGGTGGGG - Intergenic
1069503062 10:68971592-68971614 CTCATCACACAAATGAGGAAAGG + Intronic
1069832927 10:71291918-71291940 CCCATCTCACAGATGGGGAAAGG + Intronic
1070637065 10:78137562-78137584 CTCATCCCAAAGATGGCGGCTGG + Intergenic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071586132 10:86823369-86823391 CTCATTTTACAGATTGGGTACGG + Intronic
1072694740 10:97594834-97594856 CTAATCCCACACATGGGGGTGGG + Intronic
1073786403 10:106895079-106895101 CTCATCTGACAGATGAAGTAGGG - Intronic
1074491194 10:113941123-113941145 CTCATCCTACAAATGAGGAAAGG + Intergenic
1079067447 11:17308193-17308215 CTCATTCCAGAGCTGGGGCAAGG - Intronic
1079136091 11:17776723-17776745 CTCATCCAAAGGATGGGGCAGGG + Intronic
1080679374 11:34459705-34459727 CTCCACCCATAGGTGGGGTAAGG + Intronic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1083488663 11:62999079-62999101 CTCCTCCCACAGATGTGGAATGG - Exonic
1083939135 11:65885811-65885833 CTCTTCGCACAGATGGGGAAGGG - Intronic
1084333320 11:68442723-68442745 CTCCTCCCGGAGATGGGTTACGG - Intronic
1084877084 11:72140976-72140998 CTCATCTTACAGGTGGGGAAAGG + Intergenic
1087307232 11:96501548-96501570 TTGATACCACAGATGGGGCAAGG - Intronic
1089523977 11:119084774-119084796 CTCATGTCACAGCTGGGGAATGG + Intergenic
1089700468 11:120241078-120241100 CTCCTTCCACAGCTGGGCTAAGG + Intronic
1090408570 11:126492309-126492331 CTCATCCCTCATCGGGGGTAGGG - Intronic
1090427746 11:126620849-126620871 CTCATCCAGCAAGTGGGGTACGG - Intronic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1097272970 12:57789946-57789968 CCCATTCCACAGTTGGGGAAAGG - Intronic
1102639295 12:114352462-114352484 CACCTCCCCCAGATGGGGTTAGG + Intergenic
1104231420 12:126888334-126888356 CTCATCCACCCCATGGGGTAGGG + Intergenic
1110804100 13:79735439-79735461 CTCATCCCAGAGCTGTGGTCAGG - Intergenic
1113343176 13:109446809-109446831 CTCATCTGACAGATGTGGTGTGG + Intergenic
1117128743 14:52662627-52662649 TTCATATTACAGATGGGGTAGGG + Intronic
1119668048 14:76498836-76498858 CCCAGGCCACAGATGGGGGAGGG - Intronic
1119891837 14:78188577-78188599 CTCTGCCTACAGATGGGGGAAGG + Intergenic
1122158805 14:99768102-99768124 CTTCTCCCAGAGATGGGGCACGG + Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1129047921 15:72753225-72753247 CTCTTACCACTGATGGGGCATGG + Intronic
1129352241 15:74962858-74962880 CTGGCCCCACAGATGGGGAATGG + Intronic
1131337838 15:91566875-91566897 CTCAGCCCATAGATGGGGAAAGG + Intergenic
1132024259 15:98391599-98391621 CTCATCTGCCAGATGGGGCAAGG + Intergenic
1132696884 16:1205975-1205997 TGCATCCCACAGATGGGAGAGGG - Intronic
1132898161 16:2238581-2238603 CCCGTCCCACAGATGGGGAACGG - Exonic
1134682266 16:16134497-16134519 ATCATCCCCCAGGTGGGGTCTGG + Exonic
1138101379 16:54254754-54254776 CTTATCCTAAAGATGAGGTAAGG + Intronic
1140588212 16:76319803-76319825 CTAAGCCCACAGAGGGAGTATGG + Intronic
1141260859 16:82452486-82452508 CCGACCTCACAGATGGGGTAGGG + Intergenic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1141881885 16:86865722-86865744 CTAATTCCACAGATGAGGAAAGG - Intergenic
1142236100 16:88923283-88923305 CTCATCGCACAGAGGAGGTGAGG + Intronic
1143121800 17:4612551-4612573 CTGATTCCACAGTTGGGGCAAGG - Intergenic
1144684455 17:17216642-17216664 CTCAGCCCACAGTGGGGGTGAGG + Intronic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1149486770 17:57048298-57048320 CTCAGCCCTCTGATGTGGTAAGG + Intergenic
1150379551 17:64709823-64709845 CTAATACCACAGATGGGGAAGGG - Intergenic
1151288851 17:73133830-73133852 CCCATCTTACAGATGGGGAAGGG + Intergenic
1152458547 17:80429693-80429715 CTCACACCCCAGATGGGGTCTGG - Intronic
1152532913 17:80930823-80930845 TTCCTCCCACAGCTGGGGCAGGG + Intronic
1155107720 18:22684126-22684148 CTGATCCCACAGAAGGGACAAGG + Intergenic
1155916607 18:31563912-31563934 TTCATTCCACTGATGGGGTTGGG + Intergenic
1156029249 18:32693148-32693170 CTCATCCCCCACCTGGGGGAAGG + Intronic
1156322493 18:36039356-36039378 CACATCCCCCAGAAGGGGCATGG + Intronic
1157595653 18:48862184-48862206 CTCATGCCACAGAGAGGGGATGG - Intronic
1157790896 18:50529969-50529991 CTGCTCCCACAGAGGGGGTGGGG - Intergenic
1158664569 18:59420845-59420867 CTTCTCCCACAGCTGGGGTCAGG + Intergenic
1158932063 18:62332212-62332234 CACATCCCACAGATGGGAAATGG + Intronic
1162011148 19:7815880-7815902 AACATCCCACAGAAGGGGTGGGG + Intergenic
1162150224 19:8639765-8639787 CATATACCACACATGGGGTAAGG + Intergenic
1164643624 19:29843499-29843521 CTCCTCCCAGAGGTGGGGGATGG - Intergenic
1165385705 19:35509679-35509701 CTTATACCACAGATGGGGCTGGG - Intronic
1167467618 19:49658472-49658494 GTCATCCCACTGACGGGGGAGGG - Exonic
1167471910 19:49680184-49680206 CTCAGCCCACAGCTGGGGAGGGG - Intronic
1167744069 19:51340701-51340723 CTGAACCGACAGCTGGGGTAGGG + Exonic
1168593245 19:57653823-57653845 TTGATACCACAGATGGGGCAAGG - Intergenic
1202675756 1_KI270711v1_random:4980-5002 CTCTGCCCGCAGATGGGCTAAGG + Intergenic
926676460 2:15626803-15626825 CTCCTCCTACAGATTGGGAAGGG + Intronic
926947959 2:18209443-18209465 CTCAGCCCACAGTGGGGTTATGG + Intronic
927709282 2:25314946-25314968 CTCAGGCCACAGCTGGGGTGGGG + Intronic
929957333 2:46468296-46468318 TTGATCCCAGAGATGGGGTCTGG - Intronic
932701495 2:73995361-73995383 CTCAGACCTCAGTTGGGGTAAGG + Intronic
933572991 2:84035686-84035708 TTCATCCCACTGATGAGGAATGG + Intergenic
937249945 2:120517279-120517301 CCCATTTCACAGATGGGGGAAGG + Intergenic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
939024736 2:136998457-136998479 TTCCTCCCACAGATGAGATAAGG - Intronic
946161192 2:217836999-217837021 CTCTTCCCACAGCTGGGCTGAGG + Intronic
946733111 2:222728143-222728165 CTCCTCTCACACATGGGGTCAGG - Intergenic
1168837319 20:885845-885867 CTCTTGCCACACATGGGGTTAGG - Intronic
1170561567 20:17563085-17563107 CTCATCCCACAGATGGGGTAAGG - Intronic
1171234193 20:23510933-23510955 CTAATCCTACAGATGGAGAAGGG + Intergenic
1174132701 20:48357326-48357348 CTCCTCCCACAGGTGGAGGAGGG - Intergenic
1176867764 21:14063415-14063437 CACACCCCGCAGCTGGGGTATGG + Intergenic
1179201164 21:39222414-39222436 CTGATTCCACAGCTGAGGTAAGG + Intronic
1179636323 21:42712860-42712882 CTCATCCCATAGATGCAGAAAGG - Intronic
1181316278 22:21972796-21972818 CTCATCCCACAAATGAGGAGGGG + Intronic
1181354693 22:22291110-22291132 CCTACCCCACAGAAGGGGTATGG + Intergenic
1181582469 22:23835806-23835828 CTCACCCCACAGGTCGGGCAGGG + Intronic
1181869256 22:25885236-25885258 CCCATCTCACAGATGAGGCAAGG + Intronic
1182423610 22:30260415-30260437 CTCTTCCCCCAGCTGGGGCAGGG + Intergenic
1182520992 22:30884508-30884530 CTCATCCCAGAGATGTGAAATGG - Intronic
1183340561 22:37278387-37278409 CTCATCTTACAGATGGGAAACGG - Intergenic
949735312 3:7164880-7164902 CTCAACCCAGAGATGGGCAAGGG - Intronic
951921770 3:27862527-27862549 GGCATCCCACAGCTGGGATAAGG + Intergenic
954295112 3:49670150-49670172 CTCATCCCAAAGATCAGGTATGG + Exonic
959520918 3:107322113-107322135 CTCAACCCATGGAAGGGGTATGG + Intergenic
959654086 3:108781099-108781121 CTCATCCCAAAAATGGGATTTGG - Intergenic
961191732 3:124968052-124968074 AATATCCCACAGATGGGGGAAGG - Exonic
961372918 3:126442347-126442369 GTCCACCCACAGGTGGGGTATGG - Intronic
961437881 3:126931905-126931927 CTCATCACAAAAATGGGGTGAGG - Intronic
965638553 3:170809405-170809427 CTCCTCCCACAAATGGGGCTAGG - Intronic
965816816 3:172644561-172644583 CTCATCGCATAGATGGGGTAGGG - Intronic
966475648 3:180342407-180342429 CTTACCCCACAGATGGAGAAGGG - Intergenic
966696558 3:182794770-182794792 CTCATCACACAGATAAGGTTAGG - Intronic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
969377489 4:6772344-6772366 CTCATCTGACAAAGGGGGTAAGG + Intergenic
969476455 4:7425006-7425028 CTCGGCCCACAGATGGGGCAAGG - Intronic
970511577 4:16786948-16786970 ATCATCTCACAGATGGGATAGGG - Intronic
973023574 4:45236194-45236216 CCCATCCCCCAGCTGGGATAAGG + Intergenic
975647084 4:76555821-76555843 CTTTTCCCAGAGGTGGGGTAGGG - Intronic
982055307 4:151543190-151543212 CTCATCCAGCAGATGTGGCAGGG + Intronic
983621057 4:169761184-169761206 CTCAACCCACTGAAGAGGTATGG + Intergenic
984465877 4:180100421-180100443 CTCACCCCAGAGCTGCGGTATGG - Intergenic
986067004 5:4244325-4244347 CTCATCCCTCACCTGGGTTATGG - Intergenic
989575709 5:42986349-42986371 CTCAATCTACAGATGGGGTCTGG + Intergenic
992917588 5:81474144-81474166 CTCATCTTTCAGATGGGCTAAGG + Intronic
993540674 5:89146883-89146905 CTGATTCCAGAGCTGGGGTAAGG - Intergenic
998202650 5:140137499-140137521 CTCATCTCAGAGATGGGGGCAGG + Intergenic
998348965 5:141488495-141488517 CTCATTCCACATTTGGGGTCTGG + Intronic
998546683 5:143034564-143034586 TTCTTCCCACAGCTGGGGGAAGG + Intronic
1000234361 5:159343992-159344014 CTCATCACAAAGATGATGTAAGG - Intergenic
1001841047 5:174877111-174877133 CCCATCCTACAGATGGGGAAAGG + Intergenic
1002102923 5:176866241-176866263 CTCACATCAAAGATGGGGTAGGG + Intronic
1006810611 6:36818081-36818103 CTCATCCTACAGACGGGGGCAGG - Intronic
1006931564 6:37692116-37692138 CTCATCCCTCAGATAGGGTGAGG + Intronic
1009869685 6:69438236-69438258 TTCTTCCTACAGATGGGATATGG + Intergenic
1010133526 6:72523328-72523350 CTCCTCCACCAGATGGGATATGG - Intergenic
1017706991 6:157132604-157132626 TGCATCCCACAGATTGGGCAGGG + Intronic
1019701348 7:2476278-2476300 CTCTGCACAGAGATGGGGTATGG - Intronic
1024122604 7:46260438-46260460 CTCATCCCACAAGTGGTGTTGGG + Intergenic
1024581572 7:50805101-50805123 CCCATCTCACAGATGAGGAAAGG - Intergenic
1025839028 7:65126578-65126600 CACCTCCCACAGAAGGGCTAGGG - Intergenic
1025884038 7:65569387-65569409 CACCTCCCACAGAAGGGCTAGGG + Intergenic
1025889406 7:65633219-65633241 CACCTCCCACAGAAGGGCTAGGG - Intergenic
1026389930 7:69890285-69890307 CTCATCCCACAGCTGAGTTTAGG + Intronic
1027705853 7:81532525-81532547 CTCAGCCCAGAGATCTGGTAAGG + Intergenic
1027846289 7:83380627-83380649 CTCAACCAAGAGATTGGGTAGGG - Intronic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1029887469 7:103888377-103888399 CTCTTCCCACAGCTGGGGCTTGG + Intronic
1030680603 7:112430126-112430148 CTCATTCCACAGAGGGAGTTAGG + Intronic
1031853046 7:126888758-126888780 CACCTCCCACAGAAGGGCTAGGG + Intronic
1037710635 8:21352707-21352729 CTCCTCCCAGACATGGGGGAGGG + Intergenic
1037877078 8:22553566-22553588 CTCATCCCAAGGCTGGGGAAGGG - Intronic
1043242439 8:77952287-77952309 CTCATGCCACAGAGGCTGTATGG + Intergenic
1044625996 8:94235376-94235398 CCCAACCCACAGATGGGGAGTGG - Intergenic
1045274690 8:100692426-100692448 CTGGTCCCAGAGCTGGGGTAAGG + Intronic
1045863269 8:106837011-106837033 CTCATCCCACAGCTGGGAGGAGG + Intergenic
1051234982 9:14990323-14990345 CTCATCCCACTGAAGAGCTATGG - Intergenic
1051414560 9:16825368-16825390 CTCATTCCACAATTGGGGTGGGG + Intronic
1052574806 9:30279038-30279060 CTCATCCCACAGCTGGCCTGGGG + Intergenic
1055977309 9:81967933-81967955 CTCACCTCACAGAGGGGGTCTGG - Intergenic
1056377205 9:86026023-86026045 CTCATTCCACAGAAGGTTTAAGG + Intergenic
1056698709 9:88883569-88883591 TTCATACCACAGATGAGGGATGG - Intergenic
1056755084 9:89376768-89376790 CTCCTCCCACAGGTGGGGGGCGG - Exonic
1061304715 9:129725619-129725641 CAGATCCCCCAGATGGGGAAAGG - Intergenic
1061322579 9:129840326-129840348 CTCATCTCACAGAGGAGGAATGG - Intronic
1061363257 9:130157024-130157046 CTCATCTTACAGATGGGAGAAGG - Intergenic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1062098924 9:134717896-134717918 CTCAACCCAGGGATGGGGGATGG + Intronic
1062318569 9:135979664-135979686 CCCATGCCACAGATGGGGACCGG - Intergenic
1062680699 9:137778395-137778417 CGCATTGCACAGATGGGGTGTGG - Intronic
1187604627 X:20870068-20870090 CTCATCCCAGTGGTGGGGGAGGG + Intergenic
1189622224 X:42854013-42854035 ATTAACCCACAGATGGGGAAGGG + Intergenic
1189629334 X:42934766-42934788 CTCAGCCCACAGTAGGGGCAAGG - Intergenic
1190534051 X:51408275-51408297 CTCATCCCACTGCTGAGGGATGG - Exonic
1192706491 X:73532236-73532258 CTCTTCCCACAGAAGGGAAATGG + Intergenic
1192873972 X:75209682-75209704 TTGATACCACAGATAGGGTAAGG + Intergenic
1195086366 X:101418046-101418068 CTCAGCCCACAGATCGGGGGGGG - Intergenic
1195698940 X:107687586-107687608 CACATCCCAGGGTTGGGGTATGG - Intergenic
1197148163 X:123191440-123191462 CTCATCCCACACACGGGCTGAGG - Intronic
1197774170 X:130109483-130109505 CAAATCCCTCAGCTGGGGTATGG + Intronic
1198146633 X:133864010-133864032 CCCTTCCCACAGATGGTGTCTGG + Intronic
1199215021 X:145253144-145253166 TTGATACCACAGATGGGGCAAGG + Intronic
1202302335 Y:23430058-23430080 CTAATTCCAGAGCTGGGGTAAGG - Intergenic
1202568476 Y:26240540-26240562 CTAATTCCAGAGCTGGGGTAAGG + Intergenic