ID: 1170563919

View in Genome Browser
Species Human (GRCh38)
Location 20:17583203-17583225
Sequence GGTGCTCCAACTTCATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170563919_1170563920 -10 Left 1170563919 20:17583203-17583225 CCAGGCTATGAAGTTGGAGCACC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1170563920 20:17583216-17583238 TTGGAGCACCCATACATTGCTGG 0: 1
1: 0
2: 23
3: 214
4: 807
1170563919_1170563924 20 Left 1170563919 20:17583203-17583225 CCAGGCTATGAAGTTGGAGCACC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1170563924 20:17583246-17583268 GTAAAATGGCGCAGTAATTTTGG 0: 1
1: 2
2: 13
3: 107
4: 724
1170563919_1170563923 6 Left 1170563919 20:17583203-17583225 CCAGGCTATGAAGTTGGAGCACC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1170563923 20:17583232-17583254 TTGCTGGTGAGAATGTAAAATGG 0: 58
1: 527
2: 1783
3: 3517
4: 4986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170563919 Original CRISPR GGTGCTCCAACTTCATAGCC TGG (reversed) Intronic
902682131 1:18050904-18050926 GTTGCTCCATCTGCAGAGCCTGG - Intergenic
903574450 1:24329810-24329832 GGGGCTCTCTCTTCATAGCCTGG + Intronic
909713351 1:78677484-78677506 AGTGCTCCCACTTCTTACCCTGG - Intergenic
912185177 1:107266644-107266666 GGTGTTACAACTACATAACCTGG + Intronic
914784262 1:150814121-150814143 GGTGCCCCAACTGCATCGCCTGG - Exonic
916447178 1:164883692-164883714 GGTGCTCCCATTTTATGGCCAGG - Intronic
916657916 1:166893899-166893921 GGTGCTGCACCTTCATTGTCTGG - Intergenic
916682842 1:167120060-167120082 GCCGCTCCAACTTCTTACCCTGG - Intronic
919677360 1:200396678-200396700 GCTGGTCCACTTTCATAGCCAGG + Intergenic
919825683 1:201501527-201501549 GCTGCTGCATCTTCCTAGCCTGG + Intronic
920452860 1:206073185-206073207 GGTGCTCCCACATCAGAGACAGG - Intronic
921186177 1:212671482-212671504 GATGCTGCAACTTCACAGCTAGG + Intergenic
924528865 1:244876524-244876546 GAAGCTCCAACTTCTTAGCTTGG - Intergenic
1067832894 10:49620624-49620646 GGTGCTCCTAGCTCATAACCTGG + Intronic
1073061136 10:100734575-100734597 GGGCCTCCCACTTCACAGCCTGG - Intergenic
1073571134 10:104581950-104581972 GTTGCTCCCATTTCATAGACAGG + Intergenic
1078072596 11:8126937-8126959 GATCCTCCAACTGCATAGCTGGG + Intronic
1079364906 11:19800607-19800629 TGTGCTCCAACTTGATAGCTTGG + Intronic
1083322877 11:61857878-61857900 GCTGCTCCAACTTCAAACCAGGG - Intronic
1094356932 12:29588012-29588034 AGAGCTCCAACTTCATTCCCAGG - Intronic
1098523283 12:71457951-71457973 GATGCTTCAATTTCACAGCCTGG + Intronic
1102028182 12:109725369-109725391 GGTACTCCAGCCTCAGAGCCAGG + Intronic
1110140978 13:72129265-72129287 GGTGCTACATCTTTACAGCCAGG + Intergenic
1112162031 13:96878024-96878046 GGAGCTCCAATTTCTTAGCGGGG - Intergenic
1117768992 14:59113236-59113258 GGGGCTTCACCTTCTTAGCCAGG + Intergenic
1119756593 14:77124318-77124340 GGTGCTCCAAGTGCACAGCCAGG + Intronic
1121533792 14:94677312-94677334 TGTGCTCCCACCTCAAAGCCGGG - Intergenic
1127956118 15:63855059-63855081 GTTCCTCCATCTTCAAAGCCAGG + Intergenic
1129742973 15:77999044-77999066 AGTGCTACAAATCCATAGCCAGG - Intronic
1129842506 15:78752403-78752425 AGTGCTACAAATCCATAGCCAGG + Intergenic
1131142923 15:89992308-89992330 GGTGCTGCTGCTGCATAGCCAGG + Intergenic
1131785234 15:95905195-95905217 GGTGTTCCAACTGCCTAGCACGG + Intergenic
1135063310 16:19289125-19289147 TATGCTCCAACTTCAGAGCTTGG - Intronic
1137895634 16:52208825-52208847 GTTTCTCCAAGTTAATAGCCAGG + Intergenic
1142265843 16:89063630-89063652 GATGCTCCAGCCTCACAGCCAGG - Intergenic
1147594216 17:41706238-41706260 GGTGATCCAAATACAAAGCCTGG + Intergenic
1147874832 17:43613777-43613799 GTTTCTCCAACTCCAAAGCCTGG + Intergenic
1148135972 17:45292155-45292177 GCTGCTCCAAGTTCAGAGCTAGG - Intronic
1151683495 17:75633947-75633969 TGTCCTCCAACTTCATGTCCCGG - Intronic
1154356613 18:13626680-13626702 GGTGCCCATTCTTCATAGCCAGG + Intronic
1160455686 18:78997354-78997376 GATGCTCCAACTTCAAAACGTGG - Exonic
1162739588 19:12766352-12766374 GGTGCTCCAACCCCATGGTCTGG - Intronic
1167623830 19:50573797-50573819 GGTGCTCCATCCTCACAGCATGG + Intergenic
1168314648 19:55479283-55479305 GGTGCCCCCACTCCATGGCCTGG - Intronic
928394396 2:30932472-30932494 TCTGCTGCAACTTCTTAGCCTGG + Intronic
936463449 2:112727534-112727556 GGTGGTCCATCTTCAGGGCCAGG + Intronic
942349334 2:175036611-175036633 GGGGCTCTAACTAAATAGCCGGG - Intergenic
942691301 2:178588123-178588145 GGTGCACCACCATCATAGACTGG + Exonic
948004004 2:234592370-234592392 GGTGCTCCAGGTACATACCCTGG - Intergenic
948702211 2:239767503-239767525 CGTGGTGCAACCTCATAGCCCGG - Intronic
1170563919 20:17583203-17583225 GGTGCTCCAACTTCATAGCCTGG - Intronic
1172991655 20:39041164-39041186 GCTGCTCCAGCTTCATGGGCTGG + Intergenic
1179935619 21:44601984-44602006 GGTGCTCCCAGGCCATAGCCCGG + Exonic
1181097384 22:20514912-20514934 TGTTTTCCAGCTTCATAGCCTGG + Intronic
950523268 3:13508804-13508826 GGTGCTCCCACATCCTACCCTGG + Intergenic
953407938 3:42668950-42668972 GGTGCCCCAAGGTCAAAGCCTGG - Intergenic
959551941 3:107669848-107669870 AGTGGTCAAAATTCATAGCCAGG + Intronic
971699326 4:29949038-29949060 GGTATTCAAACTTTATAGCCTGG + Intergenic
990641289 5:57786732-57786754 AGTGCTCCAACCTCATGGCTAGG - Intergenic
993106728 5:83608472-83608494 TGTGGTCCATCTTTATAGCCAGG + Intergenic
998823142 5:146074852-146074874 GGTGTTCCAAATCTATAGCCTGG - Intronic
1001001160 5:168008393-168008415 GGTGCTTCAAGTTCATAAGCGGG + Intronic
1002936630 6:1679448-1679470 GGTGCTCTATCTTCACTGCCAGG + Intronic
1005418551 6:25626619-25626641 GGATCTCAAACTTCATTGCCAGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1015543400 6:134338657-134338679 GATGCTCCAACTCCAGAACCAGG + Intergenic
1018049456 6:159996582-159996604 GTTGCTCCAGCTCCATGGCCTGG + Intronic
1019124168 6:169828206-169828228 GGAGCTCCTACTTCTTAGCTGGG - Intergenic
1028881243 7:95882429-95882451 GATGCTCAAACTTCCTATCCAGG - Intronic
1029111230 7:98213928-98213950 GGTGCTTCATCCTCATGGCCAGG + Intergenic
1031555300 7:123167828-123167850 GTTGCTCCAAGTTCATAACCTGG + Intronic
1032300068 7:130678636-130678658 GGTGCTGAAACTTCATTGCAGGG - Intronic
1035171200 7:157018277-157018299 GTTGCTCCAACCTCGGAGCCCGG - Intergenic
1037969451 8:23161542-23161564 GGTTCTCCAAGTTCACAGCTGGG + Intronic
1043790300 8:84458267-84458289 AGTCCTCCATCTTCATACCCTGG + Intronic
1047830683 8:128626572-128626594 TCTGCTCCAACTTCACAGCCAGG - Intergenic
1048278928 8:133090301-133090323 GGTGTTCCAACTCCAAACCCAGG - Intronic
1053062072 9:35039921-35039943 AGAGTTCCAACTTCTTAGCCTGG + Intergenic
1185454135 X:299244-299266 GGTGCACCAACATCATCGCGGGG + Exonic
1188608239 X:32060942-32060964 TGTGCTCCAGCTTCTTTGCCTGG + Intronic
1192317287 X:70062863-70062885 GGTGCTCCGACATCTCAGCCTGG - Exonic