ID: 1170567305

View in Genome Browser
Species Human (GRCh38)
Location 20:17614496-17614518
Sequence AGACACTCGCTTCCCAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170567294_1170567305 20 Left 1170567294 20:17614453-17614475 CCCACACAGGTGCAAAGTGAGGA 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1170567305 20:17614496-17614518 AGACACTCGCTTCCCAGCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 265
1170567303_1170567305 -9 Left 1170567303 20:17614482-17614504 CCAGCAGGGGGATCAGACACTCG 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1170567305 20:17614496-17614518 AGACACTCGCTTCCCAGCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 265
1170567302_1170567305 -3 Left 1170567302 20:17614476-17614498 CCTGGGCCAGCAGGGGGATCAGA 0: 1
1: 0
2: 0
3: 22
4: 307
Right 1170567305 20:17614496-17614518 AGACACTCGCTTCCCAGCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 265
1170567295_1170567305 19 Left 1170567295 20:17614454-17614476 CCACACAGGTGCAAAGTGAGGAC 0: 1
1: 0
2: 1
3: 16
4: 169
Right 1170567305 20:17614496-17614518 AGACACTCGCTTCCCAGCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170567305 Original CRISPR AGACACTCGCTTCCCAGCAA GGG Intronic
902805642 1:18859657-18859679 AGACCATCACTTCCCAGCCATGG - Exonic
903138905 1:21326916-21326938 ACACCCCCGCTCCCCAGCAAGGG + Intronic
908155293 1:61346896-61346918 AGAGAATCGGTCCCCAGCAAAGG + Intronic
909232354 1:73106235-73106257 AGACACCAGCTTCCCATCGAGGG - Intergenic
909898782 1:81108096-81108118 ACCCACTAGCTCCCCAGCAATGG - Intergenic
910511567 1:88012248-88012270 AGACCCTTGCTTCCTAGTAAAGG + Intergenic
912594589 1:110861368-110861390 CCACACTAGTTTCCCAGCAATGG + Intergenic
914010620 1:143775279-143775301 AGTAAGTCTCTTCCCAGCAAAGG + Intergenic
918647490 1:186920263-186920285 AGCAAGTCTCTTCCCAGCAAGGG + Intronic
919281498 1:195495586-195495608 TCACACTGGCTCCCCAGCAATGG - Intergenic
921178013 1:212609729-212609751 ACACCCTCGCTTCCCCGCCACGG - Intronic
922562157 1:226577232-226577254 GGACACTCTCTTCCCTGCACTGG - Intronic
923019295 1:230150504-230150526 AGACATTCACTTCTCTGCAAAGG - Intronic
923939503 1:238805292-238805314 ACACACATGCTTCTCAGCAATGG + Intergenic
924193115 1:241577259-241577281 TCACACTGGCTTTCCAGCAATGG - Intronic
924209506 1:241749901-241749923 AAACAATCGCTGCCCAGCCACGG + Intronic
1063404892 10:5784453-5784475 TCACACTAGCTTACCAGCAATGG - Intronic
1064913222 10:20426721-20426743 CTACACTAGCTCCCCAGCAATGG - Intergenic
1069199969 10:65601381-65601403 TCACACTAGCTCCCCAGCAATGG - Intergenic
1071362869 10:84867379-84867401 ACACAATAGCTTCCCAGCAATGG + Intergenic
1071843633 10:89499089-89499111 TCACACTAGCTTGCCAGCAATGG + Intronic
1072362392 10:94672406-94672428 AGTCACTCGATTTTCAGCAAAGG - Intergenic
1072839390 10:98753970-98753992 CCACACTAGCTTCCCAGCAATGG + Intronic
1072871763 10:99127109-99127131 TCACACTAGCTCCCCAGCAATGG + Intronic
1074759266 10:116654217-116654239 TCACACTAGCTCCCCAGCAATGG - Intergenic
1075946908 10:126440994-126441016 TCACACTGGCTTACCAGCAATGG + Intronic
1076266651 10:129113972-129113994 AGACCCCCACTGCCCAGCAATGG - Intergenic
1076285174 10:129288714-129288736 ACACTCACGCTTCCCTGCAAGGG - Intergenic
1076391248 10:130104325-130104347 AGACACTCGCATCACAGCAGAGG + Intergenic
1079464065 11:20712505-20712527 TCACACTAGCTCCCCAGCAATGG - Intronic
1080850735 11:36067241-36067263 AGACACTTTCTGCCCAGCAGTGG - Intronic
1081035533 11:38140043-38140065 AAAAACTTTCTTCCCAGCAAAGG + Intergenic
1081711569 11:45219838-45219860 AGAAATACGGTTCCCAGCAATGG + Intronic
1083197375 11:61096594-61096616 AGCAAGTCTCTTCCCAGCAAGGG - Intergenic
1083601621 11:63952249-63952271 AGACACTCGCTTACATTCAATGG - Exonic
1083610459 11:64001798-64001820 GAACACTCACTTCCCAGCACTGG - Intronic
1084114589 11:67034658-67034680 AGACACCCACCTCCCAGCCAGGG - Exonic
1085316918 11:75550904-75550926 AGACACTGCCTCTCCAGCAAGGG + Intergenic
1087396647 11:97609267-97609289 AGACACTGGCAGACCAGCAATGG - Intergenic
1088775926 11:113082963-113082985 AAAAACTCTCTTCCCAGTAAAGG - Intronic
1089756840 11:120693608-120693630 AGACAGTCTCTGCCCACCAAAGG + Intronic
1090575273 11:128095385-128095407 AGGAACTCACTTCACAGCAAGGG + Intergenic
1091031426 11:132191641-132191663 TCACACTAGCTACCCAGCAATGG + Intronic
1092602658 12:10083328-10083350 TAACACTAGCTCCCCAGCAATGG + Intronic
1092609058 12:10153133-10153155 GCACACTAGCTCCCCAGCAATGG - Intergenic
1093078448 12:14781658-14781680 TGACACTCTTTCCCCAGCAATGG - Intergenic
1093655428 12:21688596-21688618 TTACACTGGCTTCCCAGCAATGG + Intronic
1095777119 12:46022749-46022771 TCACACTAGCTCCCCAGCAATGG - Intergenic
1096667144 12:53173423-53173445 AGCCACTGGGTCCCCAGCAAGGG + Exonic
1098227209 12:68337061-68337083 AGACACTCCCTTGTCAACAAAGG - Intergenic
1098482414 12:70980709-70980731 AGAAACTCGCTTTCCAGTTAGGG + Intergenic
1098748348 12:74267165-74267187 AGCCAGTCTCTTCCCAGCAAGGG - Intergenic
1100918650 12:99456384-99456406 ACATACTGGCTTACCAGCAATGG + Intronic
1102483282 12:113238725-113238747 ACCCACTCGCTCCCCAGCACCGG + Intronic
1106060068 13:26281603-26281625 CCACACTAGCTCCCCAGCAATGG + Intronic
1107490802 13:40878483-40878505 AGCAAGTCCCTTCCCAGCAAGGG + Intergenic
1109309020 13:60671095-60671117 TCACACTAGCTTTCCAGCAATGG - Intergenic
1109504825 13:63286563-63286585 TCACACTAGCTACCCAGCAATGG - Intergenic
1109747680 13:66647821-66647843 AGACACTCCCTTCAAGGCAATGG - Intronic
1110491914 13:76119119-76119141 TCACACTCACTCCCCAGCAATGG + Intergenic
1114694208 14:24611750-24611772 TCACACTAGCTCCCCAGCAATGG - Intergenic
1116181531 14:41542328-41542350 ATGCATTAGCTTCCCAGCAATGG - Intergenic
1116332120 14:43610810-43610832 ACACACTAGCTTTCCAGCAATGG - Intergenic
1117240815 14:53830308-53830330 TCACACTAGCTCCCCAGCAATGG + Intergenic
1120611542 14:86647074-86647096 AGACACTAGTGCCCCAGCAATGG + Intergenic
1123127142 14:105954871-105954893 TCACACTGGTTTCCCAGCAATGG + Intergenic
1123407609 15:20030691-20030713 CCACACTGGTTTCCCAGCAATGG + Intergenic
1123455993 15:20426736-20426758 ATCCACTAGCTCCCCAGCAATGG - Intergenic
1123516937 15:21037347-21037369 CCACACTGGTTTCCCAGCAATGG + Intergenic
1123635577 15:22304101-22304123 ATCCACTAGCTCCCCAGCAATGG + Intergenic
1123827845 15:24101417-24101439 AGACCCTCACTTCCCCGCCAGGG + Intergenic
1123857335 15:24426890-24426912 AGACCCTCGCTTCCCCGCCAGGG + Intergenic
1123861961 15:24477418-24477440 AGACCCTCACTTCCCCGCCAGGG + Intergenic
1125840966 15:42800990-42801012 AGACACTAGCTTCCCATCACGGG + Intronic
1126205886 15:46044217-46044239 AGATACTCTCTTCCTGGCAATGG - Intergenic
1126675164 15:51154662-51154684 AGGCACTATCTTCCCACCAACGG - Intergenic
1126841067 15:52717933-52717955 AGAGACTCCCTTCCCAGCATAGG - Intergenic
1132008020 15:98248661-98248683 CAGCACTAGCTTCCCAGCAATGG - Intergenic
1132412759 15:101597059-101597081 TCACACTAGCTTACCAGCAATGG - Intergenic
1132613171 16:827838-827860 AGACACTCGCTGCCAGGCACAGG + Intergenic
1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG + Intergenic
1136057134 16:27698831-27698853 AAGCTCTGGCTTCCCAGCAAAGG + Intronic
1138006355 16:53341522-53341544 AGACACCCGTTTTCCAGCAGGGG + Intergenic
1138729692 16:59181685-59181707 TCACACTAGCTCCCCAGCAATGG - Intergenic
1139172548 16:64648857-64648879 TCACACTAGCTTCCCAGCAATGG + Intergenic
1140932581 16:79641290-79641312 AGCCTATGGCTTCCCAGCAATGG - Intergenic
1141381675 16:83582637-83582659 AGACATTCACTTCCCAGCCGTGG + Intronic
1142940322 17:3375626-3375648 TCACACTAGCTTTCCAGCAATGG - Intergenic
1143084488 17:4405682-4405704 AGACACTGAGTTCCCAGGAAGGG - Intergenic
1145966018 17:28917835-28917857 CCACACTCCCTTCCCAGGAAGGG + Intronic
1146735303 17:35233466-35233488 GGAGACTCTCTTCACAGCAAAGG - Intergenic
1149221966 17:54425337-54425359 AGACACTCATTACCCAGAAAAGG - Intergenic
1150271761 17:63871364-63871386 TGACACTCGCTTCCCTTCAGGGG - Intergenic
1150277439 17:63908949-63908971 TGACACTCGCTTCCCTTCAGGGG - Intergenic
1150302394 17:64057296-64057318 AGACACTAGCCTCCCAGAAAAGG - Intronic
1153396281 18:4625223-4625245 TCACACTAGCTTACCAGCAATGG - Intergenic
1153828874 18:8901802-8901824 CCACACTGGCTCCCCAGCAAGGG + Intergenic
1155885705 18:31205744-31205766 AGACACTCTCCTCTCTGCAAGGG + Intergenic
1156326779 18:36080559-36080581 TGACACTAGATCCCCAGCAATGG + Intergenic
1156970678 18:43151017-43151039 AGGCACTCGCCTCCCTACAATGG - Intergenic
1157141748 18:45115093-45115115 AGACACTTGCATCTCAGCAAAGG + Intergenic
1160058890 18:75511476-75511498 TCACACTAGCTTCCCAGCAGTGG + Intergenic
1162284484 19:9728025-9728047 AGCAAGTCTCTTCCCAGCAAGGG + Intergenic
1162633321 19:11945817-11945839 AGCAAGTCCCTTCCCAGCAAGGG + Intronic
1163943490 19:20515707-20515729 AGCAAGTCTCTTCCCAGCAAGGG + Intergenic
1166909028 19:46138048-46138070 CTGCACTAGCTTCCCAGCAATGG - Intergenic
1168209544 19:54880571-54880593 CCACACAAGCTTCCCAGCAAGGG - Intronic
925095298 2:1193699-1193721 AGACTCTCGCCTGACAGCAAAGG + Intronic
933340855 2:81024776-81024798 TCACACTAGCTCCCCAGCAATGG - Intergenic
934784493 2:96995179-96995201 TGGCAGTCTCTTCCCAGCAAGGG + Intronic
935481256 2:103592889-103592911 TCACACTAGCTTTCCAGCAAAGG + Intergenic
935798552 2:106669587-106669609 ACACTCTCTCTTCTCAGCAATGG + Intergenic
937410549 2:121670938-121670960 CCACACTAGCTTCCTAGCAATGG + Intergenic
937663126 2:124452989-124453011 TTACACTAGCTTTCCAGCAATGG + Intronic
938584744 2:132679206-132679228 AGACACTTGTTTCCCAGCCCAGG - Intronic
939219453 2:139282385-139282407 TCACACTAGCTTACCAGCAATGG + Intergenic
941060729 2:160843542-160843564 CCACACTAGCTTCCCAGCAATGG + Intergenic
941357988 2:164515674-164515696 TGACACTAGCTCACCAGCAATGG + Intronic
941560798 2:167041288-167041310 CCACACTAGCTCCCCAGCAATGG + Intronic
941681113 2:168400809-168400831 TCACAGTAGCTTCCCAGCAATGG - Intergenic
943604536 2:189961354-189961376 ATACACTGGCTTCACAGCATAGG + Intronic
943912418 2:193585211-193585233 AAACACTAACTGCCCAGCAATGG + Intergenic
943943626 2:194029973-194029995 TGACACTAGCTCCCCAGCAATGG + Intergenic
944400530 2:199320618-199320640 ATACACACACTTCCCAGTAATGG + Intronic
945338159 2:208617607-208617629 TCACACTAGCTCCCCAGCAATGG - Intronic
947491146 2:230595129-230595151 TTACACTAGCTCCCCAGCAATGG + Intergenic
948773741 2:240269165-240269187 TCACACTAGCTCCCCAGCAATGG - Intergenic
949051518 2:241900152-241900174 AGACACTCTCCCCCCACCAAAGG + Intronic
1169419556 20:5449036-5449058 AGACACTAGCTTCCCCACCAAGG - Intergenic
1170567305 20:17614496-17614518 AGACACTCGCTTCCCAGCAAGGG + Intronic
1170865433 20:20151018-20151040 CCACACTAGCTCCCCAGCAATGG + Intronic
1170906305 20:20517932-20517954 TCACACTAGCTTCCTAGCAATGG + Intronic
1171461798 20:25302193-25302215 AGACATTCTCTTCCCACCCAGGG - Intronic
1173750341 20:45470746-45470768 AGAGACTCGAATCCCAGCTAGGG - Intronic
1174513150 20:51071129-51071151 AGACCCTTGCTTCCCCACAAAGG - Intergenic
1175785325 20:61708409-61708431 AGACACAGGCTTCCCAGCCAGGG + Intronic
1177657375 21:24035830-24035852 CCACACTAGCTCCCCAGCAATGG + Intergenic
1178588539 21:33889800-33889822 ACACATTCAGTTCCCAGCAAAGG - Exonic
1180608694 22:17081661-17081683 AGACACTTGCCTGCCAGGAAAGG + Intergenic
1185314838 22:50174529-50174551 GGACACTGGCTTCCCAGCCAAGG - Intronic
949661579 3:6284755-6284777 TCACACTAGCTCCCCAGCAATGG + Intergenic
950595305 3:13975272-13975294 TCACACTAGCTTTCCAGCAATGG - Intronic
951166277 3:19487799-19487821 AGCAAGTCTCTTCCCAGCAAAGG + Intronic
951238008 3:20257422-20257444 TCACACTAGCTCCCCAGCAATGG - Intergenic
952601607 3:35089675-35089697 TCACACTAGCTTACCAGCAATGG + Intergenic
952898447 3:38094642-38094664 AGCTCCTCGCTTCCCAGCCATGG - Intronic
955445927 3:59009293-59009315 TCACACTAGCTCCCCAGCAATGG + Intronic
957451132 3:80384406-80384428 GCACACTAGCTTCCCAGAAACGG - Intergenic
957681469 3:83440869-83440891 TCACACTAGCTCCCCAGCAATGG + Intergenic
957777147 3:84767882-84767904 TCACACTAGCTCCCCAGCAATGG + Intergenic
957979497 3:87490465-87490487 AAACACTAGCTTCCCAGATAAGG + Intergenic
959815356 3:110667542-110667564 TCACACTAGCTTACCAGCAATGG + Intergenic
961512817 3:127413475-127413497 AGAGAGTGGTTTCCCAGCAAAGG + Intergenic
962530408 3:136275456-136275478 TCACACTAGCTCCCCAGCAATGG - Intronic
964721082 3:159767677-159767699 AGACACTTGCTTCCAAGCAGAGG - Intronic
966122517 3:176537678-176537700 TCACACTAGCTTACCAGCAAAGG + Intergenic
966900780 3:184482517-184482539 TGACACTCCCTTCCCAGTGAAGG - Intronic
967561935 3:190926430-190926452 ACACCCTAGCTACCCAGCAATGG - Intergenic
969618468 4:8267199-8267221 AGTCTCTGGCTTCCCAGCACAGG - Intergenic
969764391 4:9216912-9216934 GCACACTCGCTTCCCTGCGAGGG + Exonic
969764995 4:9221659-9221681 GCACACTCGCTTCCCTGCGAGGG + Exonic
969765605 4:9226403-9226425 GCACACTCGCTTCCCTGCGAGGG + Exonic
969766215 4:9231148-9231170 GCACACTCGCTTCCCTGCGAGGG + Intergenic
969766828 4:9235892-9235914 GCACACTCGCTTCCCTGCGAGGG + Exonic
969767437 4:9240637-9240659 GCACACTCGCTTCCCTGCGAGGG + Intronic
969768045 4:9245386-9245408 GCACACTCGCTTCCCTGCGAGGG + Exonic
969768648 4:9250137-9250159 GCACACTCGCTTCCCTGCGAGGG + Exonic
969769252 4:9254885-9254907 GCACACTCGCTTCCCTGCGAGGG + Exonic
969769868 4:9259631-9259653 GCACACTCGCTTCCCTGCGAGGG + Exonic
969770473 4:9264379-9264401 GCACACTCGCTTCCCTGCGAGGG + Exonic
969771088 4:9269126-9269148 GCACACTCGCTTCCCTGCGAGGG + Exonic
969772070 4:9326672-9326694 GCACACTCGCTTCCCTGCGAGGG + Exonic
969772686 4:9331418-9331440 GCACACTCGCTTCCCTGCGAGGG + Exonic
969773303 4:9336165-9336187 GCACACTCGCTTCCCTGCGAGGG + Exonic
969773918 4:9340910-9340932 GCACACTCGCTTCCCTGCGAGGG + Exonic
969774533 4:9345655-9345677 GCACACTCGCTTCCCTGCGAGGG + Exonic
969775148 4:9350400-9350422 GCACACTCGCTTCCCTGCGAGGG + Exonic
969775763 4:9355145-9355167 GCACACTCGCTTCCCTGCGAGGG + Exonic
969776374 4:9359890-9359912 GCACACTCGCTTCCCTGCGAGGG + Intronic
969776992 4:9364636-9364658 GCACACTCGCTTCCCTGCGAGGG + Exonic
971531211 4:27691959-27691981 TCACACTAGCTTTCCAGCAATGG - Intergenic
971929417 4:33060879-33060901 ATACACTGCCCTCCCAGCAATGG - Intergenic
972363577 4:38351554-38351576 CCACACTAGCTCCCCAGCAATGG + Intergenic
973037394 4:45423470-45423492 TCATACTAGCTTCCCAGCAATGG - Intergenic
974912333 4:68137680-68137702 ACTCACTCCCTTCCCAGCCATGG - Intergenic
975243698 4:72093867-72093889 ATATACTAGCTTACCAGCAATGG - Intronic
975290788 4:72676608-72676630 TCACACTAGCTCCCCAGCAATGG - Intergenic
975582622 4:75920580-75920602 CAACACTCCCTTCCCAGCCAAGG + Intronic
977445351 4:97124453-97124475 CCACACTAGATTCCCAGCAATGG + Intergenic
979159962 4:117447666-117447688 TCACACTAGCTCCCCAGCAATGG - Intergenic
979595539 4:122530419-122530441 AGGAACTCACTTCACAGCAAAGG - Intergenic
982332745 4:154199828-154199850 TCACACTAGCTTCCTAGCAATGG - Intergenic
982425351 4:155252121-155252143 AGACATTAGCTCCTCAGCAATGG - Intergenic
982451160 4:155553207-155553229 TCACACTAGCTTACCAGCAATGG + Intergenic
983217620 4:165016841-165016863 AGACACATCCTTCCCAGCACAGG + Intergenic
983487812 4:168352739-168352761 CTACACTAGTTTCCCAGCAATGG - Intergenic
983785034 4:171719430-171719452 CCACACTCGCTCCCCAGAAATGG + Intergenic
983807717 4:172016599-172016621 TCACACTAGCTTCCTAGCAATGG - Intronic
984067311 4:175063880-175063902 AGTCACTGGCATCCCTGCAAGGG - Intergenic
985812031 5:2097333-2097355 AGACCCTGGCTTTCCAGCCACGG - Intergenic
985986836 5:3523035-3523057 AGACACTCACATGCCAGCAAGGG + Intergenic
986495907 5:8341111-8341133 TAACACTAGCTTCCCAGCAATGG + Intergenic
986617761 5:9637951-9637973 ACACACCGGCTCCCCAGCAATGG - Intronic
988231411 5:28484139-28484161 AGAGAGTGGGTTCCCAGCAAGGG - Intergenic
988889609 5:35600201-35600223 TCACACTAGCTCCCCAGCAATGG + Intergenic
989598124 5:43176638-43176660 AGAGAGTGGCTTCCCAGCATTGG + Intronic
989694586 5:44184506-44184528 CCACACTAGCTTCCCAGCAATGG - Intergenic
991281747 5:64922647-64922669 TCACACTAGCTCCCCAGCAATGG - Intronic
992495541 5:77289721-77289743 AGACACTGGCCTCACAGTAAAGG - Intronic
993365941 5:87034548-87034570 TTACACTAGCTCCCCAGCAATGG - Intergenic
995473551 5:112526750-112526772 AGCAAGTCTCTTCCCAGCAAGGG - Intergenic
997021600 5:130008584-130008606 ACCCACTAGCTCCCCAGCAATGG + Intronic
997105872 5:131019119-131019141 TGACACTAGCTCACCAGCAATGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998635337 5:143948600-143948622 ACACACTAGCTCCCTAGCAATGG - Intergenic
999416831 5:151405585-151405607 TCACACTAGCTCCCCAGCAAAGG - Intergenic
1001300730 5:170531810-170531832 AGCCCCACCCTTCCCAGCAAAGG + Intronic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1001676945 5:173526592-173526614 AAAACCTTGCTTCCCAGCAATGG + Intergenic
1007890996 6:45291411-45291433 ACACACTGGCTCACCAGCAATGG + Intronic
1010015414 6:71100571-71100593 TCACACTAGCTCCCCAGCAATGG - Intergenic
1010181789 6:73095452-73095474 TCACACTAGCTCCCCAGCAATGG - Intronic
1010862935 6:80936798-80936820 TTACACTAGCTTACCAGCAATGG - Intergenic
1011564419 6:88659259-88659281 TCACACTAGCTCCCCAGCAATGG + Intronic
1012191868 6:96289109-96289131 TCACACTAGCTTTCCAGCAATGG + Intergenic
1012203328 6:96433614-96433636 TCACACTAGCTCCCCAGCAATGG - Intergenic
1013727263 6:113114190-113114212 ATACACTAGTTCCCCAGCAATGG + Intergenic
1016484971 6:144528010-144528032 TCACACTAGCTTACCAGCAATGG - Intronic
1017997287 6:159543103-159543125 AGACACCCGAATCACAGCAATGG - Intergenic
1018147057 6:160901151-160901173 CCACACTAGCTCCCCAGCAATGG + Intergenic
1018728168 6:166629103-166629125 AGACACTCTGTACCCAGCACGGG + Intronic
1018781672 6:167073549-167073571 CCACACTAGCTCCCCAGCAATGG - Intergenic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1024115576 7:46189915-46189937 AGACACCTGCCTCCCACCAAGGG + Intergenic
1024847699 7:53667628-53667650 TCACACTAGCTCCCCAGCAATGG - Intergenic
1028353315 7:89876916-89876938 GTACTCTAGCTTCCCAGCAATGG - Intergenic
1033197812 7:139342199-139342221 AGACACTTGCTGCCCACCTAAGG + Intronic
1034378274 7:150665657-150665679 AGACACTGGCTTTCCTGAAAAGG - Intergenic
1034493533 7:151407222-151407244 TGACACTCACTTCCCAGGGAGGG - Intronic
1035347855 7:158217573-158217595 ACACACTAGCTACCCAGCAATGG + Intronic
1035640994 8:1185041-1185063 AGTGACTCGTTTCCCAGGAAAGG + Intergenic
1036273924 8:7333894-7333916 GCACACTCGCTTCTCTGCAAGGG + Intergenic
1036274505 8:7338622-7338644 GCACACTCGCTTCTCTGCAAGGG + Intergenic
1036346843 8:7971724-7971746 GCACACTCGCTTCTCTGCAAGGG - Intergenic
1036347421 8:7976456-7976478 GCACACTCGCTTCTCTGCAAGGG - Intergenic
1036519966 8:9482594-9482616 AGACACCTGGTTCCCAGCAATGG + Intergenic
1036520308 8:9485553-9485575 AGACACCTGATTCCCAGCAATGG + Intergenic
1036842172 8:12132480-12132502 GCACACTCGCTTCTCTGCAAGGG - Intergenic
1036864005 8:12378735-12378757 GCACACTCGCTTCTCTGCAAGGG - Intergenic
1038502995 8:28060939-28060961 AGACAGTCGCTTCCCATCAAGGG - Intronic
1040317319 8:46271510-46271532 AGACACTCAGTTCCCAGGACAGG + Intergenic
1042084310 8:65090540-65090562 CCACACTAGCTCCCCAGCAATGG + Intergenic
1043104282 8:76089057-76089079 CCACACTAGCTTCCCGGCAATGG - Intergenic
1045081064 8:98626294-98626316 AAACACTCTCTTCCCAAAAAAGG + Intronic
1046353365 8:113046163-113046185 AGACAGTCGTATCCCAGCAGAGG - Intronic
1048681484 8:136846420-136846442 TCAAACTAGCTTCCCAGCAATGG + Intergenic
1049334502 8:142075915-142075937 ACACATTCGCCTCCTAGCAACGG + Intergenic
1049671088 8:143870191-143870213 AGACACCTGCTTCCCAGAGAAGG + Exonic
1049869682 8:144965026-144965048 TCACACTAGCTCCCCAGCAATGG - Intergenic
1050684209 9:8148427-8148449 CCACACTAGCTTCCCAGCAATGG + Intergenic
1051819529 9:21148976-21148998 CCACACTAGCTTCCCAGCAGTGG - Intergenic
1052624804 9:30961757-30961779 TCACACTAGCTTACCAGCAATGG - Intergenic
1054844702 9:69781878-69781900 CTACACTAGCTCCCCAGCAATGG - Intergenic
1054966056 9:71027424-71027446 ACACACTAGTTCCCCAGCAAGGG + Intronic
1055388237 9:75788149-75788171 ACACACTAGCTCCCCAGTAATGG - Intergenic
1058044865 9:100346918-100346940 GGAGACTCACTTCTCAGCAATGG - Exonic
1058198600 9:102009836-102009858 ATACACTCCCTTCCCTGAAAGGG + Intergenic
1058572075 9:106357992-106358014 CCACACTAGCTTCCAAGCAATGG - Intergenic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1185909671 X:3970274-3970296 AGCAAGTCTCTTCCCAGCAAGGG - Intergenic
1187415013 X:19085968-19085990 AGAAACCAGCTTCCCAGCCAGGG + Intronic
1188275977 X:28200845-28200867 AGACACTAGCTGCCCAACAGAGG - Intergenic
1189689138 X:43597369-43597391 AGAGACTCACTTCTCATCAATGG - Intergenic
1190426130 X:50335842-50335864 AGCAAGTCTCTTCCCAGCAAAGG + Intronic
1190941091 X:55041789-55041811 AGACACCAGCTTCCCATCACGGG + Intergenic
1192021824 X:67402023-67402045 TCACACTAGCTCCCCAGCAATGG - Intergenic
1193219548 X:78907239-78907261 AGAGACTCTTTTCCCAGCATAGG + Intergenic
1193364077 X:80609425-80609447 ACACACTAGTTCCCCAGCAATGG + Intergenic
1193423039 X:81307777-81307799 TCACACTAGCTCCCCAGCAATGG - Intergenic
1193440741 X:81537066-81537088 AGCCACTAGCTTCCCAGCAGTGG - Intergenic
1193671175 X:84388828-84388850 ACCCACTAGCTCCCCAGCAATGG - Intronic
1194217323 X:91147371-91147393 TCACACTAGTTTCCCAGCAATGG - Intergenic
1194601371 X:95924927-95924949 ACACACTAGCTCACCAGCAATGG + Intergenic
1197664511 X:129209771-129209793 TCACACTAGCTTACCAGCAACGG - Intergenic
1198185183 X:134247806-134247828 GGTCACTGGCTTCCCACCAAGGG + Intergenic
1198582995 X:138087353-138087375 TCACACTAGCTTACCAGCAATGG + Intergenic
1198619144 X:138487692-138487714 TGACACTAGCTTCCCATCACAGG + Intergenic
1199196973 X:145042750-145042772 CAGCACTCGTTTCCCAGCAACGG + Intergenic
1199241858 X:145555953-145555975 TCACACTAGCTTTCCAGCAATGG + Intergenic
1199553664 X:149082313-149082335 TCACACTAGCTTACCAGCAATGG + Intergenic
1200318000 X:155154852-155154874 TCACACTAGCTTACCAGCAATGG - Intergenic
1200553836 Y:4611163-4611185 TCACACTAGTTTCCCAGCAATGG - Intergenic