ID: 1170568255

View in Genome Browser
Species Human (GRCh38)
Location 20:17618614-17618636
Sequence CTGTTTCTGGGCTTCGCTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 2, 2: 2, 3: 16, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170568247_1170568255 24 Left 1170568247 20:17618567-17618589 CCTGGCATGGGGACATGGAGGCC 0: 1
1: 0
2: 2
3: 30
4: 331
Right 1170568255 20:17618614-17618636 CTGTTTCTGGGCTTCGCTCTTGG 0: 1
1: 2
2: 2
3: 16
4: 202
1170568251_1170568255 0 Left 1170568251 20:17618591-17618613 CCTACCAGGGCAAGCTCATCGCT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1170568255 20:17618614-17618636 CTGTTTCTGGGCTTCGCTCTTGG 0: 1
1: 2
2: 2
3: 16
4: 202
1170568252_1170568255 -4 Left 1170568252 20:17618595-17618617 CCAGGGCAAGCTCATCGCTCTGT 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1170568255 20:17618614-17618636 CTGTTTCTGGGCTTCGCTCTTGG 0: 1
1: 2
2: 2
3: 16
4: 202
1170568250_1170568255 3 Left 1170568250 20:17618588-17618610 CCACCTACCAGGGCAAGCTCATC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1170568255 20:17618614-17618636 CTGTTTCTGGGCTTCGCTCTTGG 0: 1
1: 2
2: 2
3: 16
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170568255 Original CRISPR CTGTTTCTGGGCTTCGCTCT TGG Exonic
902101676 1:13995909-13995931 CTGTTTCTGGTCTGCCATCTTGG - Intergenic
902613313 1:17609798-17609820 CTGTTCCTGGGCTTCTGCCTGGG - Intronic
902652522 1:17845828-17845850 CTGTCTCTGGGTCTCTCTCTGGG + Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905624986 1:39483630-39483652 CTGTGTCTTTGCTTCTCTCTTGG - Intronic
905927274 1:41760393-41760415 CTGTCTCTGGGCTTCTCTGCTGG + Intronic
908684637 1:66701823-66701845 CTGTTTCTGGCCTGAGGTCTAGG + Intronic
912598508 1:110903475-110903497 CTGTTTCAGGCCCTAGCTCTTGG + Intergenic
913140455 1:115936105-115936127 TGGTTTCTGGGCTTCGCTAGTGG + Intergenic
914703618 1:150154274-150154296 GTGTTTCTGGGAATTGCTCTTGG + Intronic
920042353 1:203109569-203109591 CTGTTTCTAGGCTTTCTTCTAGG - Intronic
921278913 1:213546064-213546086 CCATTTCTGGGCTTCGGTCCAGG - Intergenic
921749421 1:218775557-218775579 CTGGTGCTGGGCCTCTCTCTGGG - Intergenic
922208072 1:223466609-223466631 CTCTTTCTGGCCTTGGCTTTAGG - Intergenic
923127133 1:231041773-231041795 CTGCTTCTGGGGTGGGCTCTAGG - Intergenic
924794471 1:247283185-247283207 CTGTTTCGGGACATCGATCTAGG + Intergenic
1064697997 10:17987589-17987611 CTGTTTGTGGGCTTGGCCGTCGG + Exonic
1065731974 10:28717821-28717843 CTGTTTCTTGACTTCTCTCCAGG + Intergenic
1066174958 10:32893724-32893746 GTGTTACTGGGCTTCACTGTAGG - Intergenic
1066708250 10:38204054-38204076 CTGATTCAGGCCTTGGCTCTTGG + Intergenic
1067396605 10:45925594-45925616 CTGTTTCTGGGTTTACCACTTGG + Intergenic
1067991449 10:51217665-51217687 CTGTTTCTGGCCTTAGTTCTGGG + Intronic
1068853878 10:61776654-61776676 CTGTTTCTGGGATGCTCTTTGGG - Intergenic
1070191297 10:74114162-74114184 CTGTATCTTTGCTTCCCTCTAGG + Exonic
1070722031 10:78763698-78763720 CTGTTTCTGCGCTTGACACTGGG + Intergenic
1074843634 10:117377287-117377309 CTGCTTCTGGGCTGCTCTCTGGG + Intergenic
1075965958 10:126611794-126611816 CCATTTCTGGGGTTCTCTCTGGG + Intronic
1076345535 10:129776387-129776409 CTGTTTCTGGGCATCGCACCTGG - Intergenic
1076450647 10:130554800-130554822 CTGTCTCTGGGCCTCCCTCCAGG + Intergenic
1076758145 10:132585938-132585960 GTGTGTCTGGGCTTCCCTCTGGG + Intronic
1077337707 11:2012809-2012831 GTGTTTCTGGACCTCACTCTTGG + Intergenic
1077480331 11:2811617-2811639 CTCCTTCTGGGCTGCGGTCTAGG + Intronic
1079330517 11:19529204-19529226 CTGTTCCTTGGATTAGCTCTTGG + Intronic
1081546800 11:44077585-44077607 CTGTTTCTGGGTCTGGCTCTTGG - Intronic
1084380854 11:68811875-68811897 GTGTCTCTGGGCTTATCTCTTGG + Intronic
1084651169 11:70490302-70490324 CCGTTTCTGGGCATCCCTCGAGG - Exonic
1087313368 11:96577087-96577109 CTGATTCTAGCCTTGGCTCTTGG - Intergenic
1087402377 11:97684076-97684098 TTGATTCTGTGCTTGGCTCTTGG - Intergenic
1088349583 11:108870536-108870558 CAGATTCTGGCCTTCGCTCTTGG + Intronic
1088688836 11:112307307-112307329 CTGTTTCTGGGTTTCCCACATGG + Intergenic
1089156748 11:116408715-116408737 CTGTTTCTGGGATTCACTAATGG - Intergenic
1089292673 11:117447672-117447694 CTGTGTATGGCCTTGGCTCTAGG - Intronic
1089491116 11:118884946-118884968 TTGTTTCGGGGCTGCACTCTGGG + Intronic
1089643636 11:119864010-119864032 CAGTTTCTGGGCTGCACTCCTGG + Intergenic
1091352415 11:134907806-134907828 CTGTCTCTGGGCTTCTCTGGGGG + Intergenic
1202820691 11_KI270721v1_random:67991-68013 GTGTTTCTGGACCTCACTCTTGG + Intergenic
1092324961 12:7521233-7521255 CAGATTCTGGGCTTCTCTTTAGG + Intergenic
1092771395 12:11900428-11900450 GTGTTTCTGGGGTTCCTTCTGGG - Intergenic
1093045763 12:14442416-14442438 CTGATTCTGCCCTTCACTCTGGG + Intronic
1097287558 12:57889503-57889525 CTGTTTCCCTGCTTCCCTCTGGG - Intergenic
1097966463 12:65586829-65586851 CTGTGTCTGGGCTAGGTTCTGGG + Intergenic
1099678574 12:85793999-85794021 CAGTTTCTGCTCTTAGCTCTTGG - Intergenic
1100536706 12:95518353-95518375 GTATTTCTGTGCTTCACTCTAGG - Exonic
1100580536 12:95935443-95935465 CTGTTCCTGGGCTATGTTCTTGG - Intronic
1100864132 12:98837627-98837649 ATGTTTCTGGGTTTGGCTGTGGG + Intronic
1102469695 12:113152793-113152815 CTGTTTCAGGGCTGCCGTCTTGG - Exonic
1103125229 12:118416374-118416396 CTTTTTCTGGCCTTCTCTGTGGG + Exonic
1105954644 13:25268985-25269007 CAGTATCTGGGCTTGGCTATTGG - Intronic
1107823876 13:44310198-44310220 CTGTTTCTAGGTCTCACTCTGGG + Intergenic
1110036090 13:70686519-70686541 CTGGTTCTGGGCTTTTCTTTTGG + Intergenic
1113112177 13:106835073-106835095 CTTTTTCTGTGCTTCTATCTGGG - Intergenic
1114942821 14:27636842-27636864 CTGTTTCTGGCCATGGCTCAAGG + Intergenic
1116381803 14:44278286-44278308 CTGTTTCTGCTCTTTGCTTTTGG - Intergenic
1116586051 14:46706193-46706215 CTGTTTCTTGTCTGCTCTCTCGG - Intergenic
1122229643 14:100299350-100299372 CTGTCTCTGGGCCTCACTCTGGG + Intronic
1122245941 14:100403589-100403611 CTGTATCTGTGCTAAGCTCTGGG - Intronic
1124108776 15:26767168-26767190 GTGTGTCTGTGCTTGGCTCTAGG - Intronic
1127382672 15:58443411-58443433 GTGTTTCTGGGCTTGACTTTGGG - Intronic
1127552950 15:60059237-60059259 CTGGCTCTGGGCTTGGCTATGGG + Intronic
1128458568 15:67848444-67848466 GTGTTTCTGGGCTTCGACCAAGG - Intergenic
1129385265 15:75192778-75192800 CTGGTCCTGGGTTTCTCTCTGGG + Intergenic
1132739824 16:1406144-1406166 CTGTTTCAGTGCTGTGCTCTGGG - Intronic
1132885296 16:2179705-2179727 CGGCTTCCGGGCTTCGCCCTCGG + Exonic
1136355364 16:29741727-29741749 CTGTTTCTGAGCTGGGCACTGGG - Intergenic
1136577243 16:31132040-31132062 CTGCCTCTGGGCCTGGCTCTGGG - Exonic
1137732216 16:50697421-50697443 CTGTTTCTGGGCTGTTTTCTGGG + Intronic
1138224357 16:55279798-55279820 CTGTTTCTGAGCTCTGCTCCGGG - Intergenic
1138277726 16:55748311-55748333 CTGTTTCTGGGCTTGGCCAGAGG - Intergenic
1138389214 16:56658010-56658032 CTGCTTCTTCGCTTCTCTCTTGG + Exonic
1142221688 16:88857958-88857980 CTGCTCATGGGCTTCCCTCTTGG + Intronic
1144277565 17:13688755-13688777 ATTATTCTGGGCTTCGGTCTAGG - Intergenic
1149354189 17:55822774-55822796 CTGATTCTGAGCTTCCCGCTTGG - Intronic
1149612402 17:57967181-57967203 CTGTTTCTGGCCTTGGTACTTGG + Intergenic
1151371690 17:73650769-73650791 CTGCCTCTGGACTTTGCTCTTGG + Intergenic
1151929905 17:77225782-77225804 CTGTTGCTTGGCTTCACTCTTGG - Intergenic
1152458048 17:80427258-80427280 CAGTTTCTTGGGTTCTCTCTCGG - Intronic
1153504237 18:5779804-5779826 TTGCTTCTAGGCTTCTCTCTTGG - Intergenic
1153757691 18:8300643-8300665 CTGTTTCTGGGCATTGCGGTGGG + Intronic
1155073843 18:22338436-22338458 CTGTCTCTGTGCCTCTCTCTGGG - Intergenic
1156369640 18:36461146-36461168 CTGTTTCTGTGCCATGCTCTGGG + Intronic
1157291121 18:46410608-46410630 GTGTTTCTGGGCATGGCTCCAGG - Intronic
1157471247 18:47990867-47990889 CTTACTCTGGGCTTAGCTCTGGG - Intergenic
1157555661 18:48611375-48611397 CTGGTTCTGAGCTCCGCCCTGGG + Intronic
1157701996 18:49767277-49767299 CTGGTCCAGGGCTTGGCTCTGGG + Intergenic
1158677088 18:59529779-59529801 CTGTTTCTGGTCATTGATCTTGG + Intronic
1159467201 18:68799418-68799440 TTGTTTCTGGGCCTCACTATGGG + Intronic
1160826820 19:1084087-1084109 CGGTTTCTCGGGTTTGCTCTTGG + Intronic
1161194765 19:2980281-2980303 CTGTTCCTGAGCCTGGCTCTTGG - Intronic
1162634387 19:11955614-11955636 CAGTTTCAGGGCTTAGCTTTGGG + Intronic
1163148449 19:15397926-15397948 CTGTTTCAGGGCTTGTGTCTGGG - Intronic
1164408570 19:27977079-27977101 CTGATTCAGGCCTTGGCTCTTGG + Intergenic
1166278522 19:41773588-41773610 CTGTTTTTAGGCTTGGCTTTTGG + Intergenic
1168086071 19:54047670-54047692 CTGTTTCTCTGCTTCCATCTGGG - Intronic
925154759 2:1640521-1640543 CTGTTTGTGGGCTCCGCTGTGGG - Intronic
926124705 2:10265028-10265050 CAGTTTCTGGGCTGCGTTCCTGG + Intergenic
926874310 2:17457811-17457833 CTGTCTCTGGACTTCGCTCATGG + Intergenic
927210467 2:20636058-20636080 CCATGTCTGGGCTTAGCTCTGGG - Intronic
927923892 2:26996056-26996078 CTGCTTCTGGGGTTTGTTCTTGG + Intronic
928094127 2:28393593-28393615 CGGGCTCTGGGCTTCGCTCCTGG - Exonic
928293555 2:30061313-30061335 CAGTTTCAGGTCTTGGCTCTTGG + Intergenic
928704266 2:33930622-33930644 AGGTTTCTGGGCTTCTCTCTAGG - Intergenic
932276228 2:70454223-70454245 CTGTTGCTGGGCTTCTCTCTTGG + Intronic
934615658 2:95769129-95769151 ATGTCCCTGGGCTTGGCTCTTGG - Intergenic
934645240 2:96055429-96055451 ATGTCCCTGGGCTTGGCTCTTGG + Intergenic
934838645 2:97611518-97611540 ATGTCCCTGGGCTTGGCTCTTGG + Intergenic
938804350 2:134792204-134792226 ATGTATCTGGGCTTCTCTCAAGG + Intergenic
941135338 2:161710307-161710329 CTGTTTCTTGGCATTGCTTTGGG + Intronic
942458746 2:176155364-176155386 ATGTTTCTTGGCTTTCCTCTGGG - Intronic
943910655 2:193562463-193562485 CTGGTTCTGCACTTTGCTCTCGG + Intergenic
944201057 2:197107848-197107870 CTGTTTGTTGGCTTCCTTCTGGG - Intronic
944789517 2:203110261-203110283 CAGTTTCTGTGATTCCCTCTGGG + Exonic
945636390 2:212357598-212357620 CAGTGTCTGGGCTTCTCTGTGGG - Intronic
945759284 2:213893037-213893059 CTGTTTTTGGGATTCACTCTTGG - Intronic
947102385 2:226635412-226635434 CTATCTCTGGACTTCACTCTTGG + Intergenic
947265423 2:228274336-228274358 CTGTGCCTGGCCTTGGCTCTGGG + Intergenic
947309187 2:228781792-228781814 CTGTTTCTGGGAGTTGATCTAGG - Intergenic
947547519 2:231020933-231020955 CTGTCTCTGGGCATTGCCCTTGG + Intronic
948338217 2:237227987-237228009 CTGTTCCTTAGCTTTGCTCTTGG + Intergenic
948880663 2:240855720-240855742 CAGTTTCTGGGCTTTGCTCCTGG - Intergenic
1170568255 20:17618614-17618636 CTGTTTCTGGGCTTCGCTCTTGG + Exonic
1172584492 20:36073221-36073243 CCTTTTCTGGGCCTCTCTCTGGG - Intergenic
1172591627 20:36122053-36122075 CTGTTCCTGGGCCTTGCTCACGG + Intronic
1173202148 20:40962048-40962070 CTGTTCCTGGGCTTGAATCTTGG - Intergenic
1173217410 20:41098294-41098316 CTGTTTCCGAGCTTCCGTCTGGG - Exonic
1173794939 20:45853213-45853235 CTGCTTCTTTGCTTCGCTCTTGG - Intronic
1174857436 20:54059924-54059946 CTGTTGCTGGGCTGGGCACTAGG + Intronic
1181078703 22:20399949-20399971 TTGTTTCTGGGATTTGTTCTGGG + Intronic
1181422569 22:22811892-22811914 CTGTGTCTGGGCTTTGCACAGGG - Intronic
1183784690 22:40022612-40022634 GTCTTTCTGGGCATCTCTCTGGG + Intronic
1184455486 22:44607514-44607536 CTCTTTCTGTGCCTCTCTCTGGG - Intergenic
950504930 3:13388809-13388831 CTGTGACTGGGCTGTGCTCTTGG - Intronic
952940495 3:38440648-38440670 GTGCTTTTGGGCTACGCTCTTGG + Intergenic
953250148 3:41238423-41238445 CTGTTTCTAGGCTCAGATCTCGG + Intronic
953853073 3:46480540-46480562 CTGGTGCTGGGCCTGGCTCTGGG + Intronic
956736489 3:72242533-72242555 CTGTTTCTGGCCTCCCATCTTGG - Intergenic
957211815 3:77268787-77268809 CCTTTTCTGGGCATGGCTCTTGG + Intronic
961104457 3:124229331-124229353 CTGTTGCAGGGCTCCACTCTAGG + Intronic
967390217 3:188947839-188947861 CTGGTTCTGGGCTTCGCTCTCGG + Intronic
967514051 3:190346149-190346171 CTGTTTCTTTCCTTCGGTCTCGG - Intronic
970145080 4:13027563-13027585 CTGTTTCTGGACTCCCTTCTTGG + Intergenic
973024695 4:45252416-45252438 CTTTGTCTGAGCTTGGCTCTGGG - Intergenic
974528169 4:63072880-63072902 CTGTTTCTGGGATTTTCTTTTGG - Intergenic
977996957 4:103505752-103505774 CTGAGTCTGGGCTTTGTTCTCGG - Intergenic
982344263 4:154339355-154339377 CTGTTTCTGGGTGTCTCTGTGGG - Intronic
988316350 5:29634782-29634804 TTGTTTCTGGGCTTGTATCTGGG - Intergenic
990087870 5:52000960-52000982 CTGCTTCTGGGATCAGCTCTGGG + Intergenic
993044963 5:82856609-82856631 CTTTTTCTGGCCTTTTCTCTTGG + Intergenic
994338204 5:98594459-98594481 CTGTTTCTAGGCTTTCCACTGGG + Intergenic
994350592 5:98742098-98742120 CTGTTTCTAGTCATCCCTCTTGG - Intergenic
995191938 5:109327231-109327253 CTGTTTCTCTGCTTCGGTTTTGG - Intergenic
995506820 5:112869504-112869526 CTGTTTCAGGGATCCACTCTTGG - Exonic
997003198 5:129785918-129785940 GTCTTTCTGGGATTCGCTCCTGG - Intergenic
997201180 5:132011165-132011187 CTGTTCCTGGCCTTGGCTCAGGG + Intronic
1002805120 6:566556-566578 CTGATTCTGGTCTTCACACTGGG - Intronic
1002934063 6:1656788-1656810 CTGGATCTGGGCTTGGCTCCTGG + Intronic
1005309645 6:24547343-24547365 ATGCTTCTGTGCTTCTCTCTAGG - Exonic
1010739823 6:79487573-79487595 ATGTTTTGGGGCTTCTCTCTGGG + Exonic
1010745055 6:79551563-79551585 CTGTTTCTGGTCTTGGCTGGAGG - Intergenic
1016418057 6:143854074-143854096 CTGGTCCTGGGCTTCTCTTTTGG + Intronic
1018175150 6:161172176-161172198 CAGCTTCTGGGCTTTTCTCTAGG - Intronic
1018493402 6:164321243-164321265 ATGTTTCTGGGATTCAGTCTGGG + Intergenic
1019929282 7:4212946-4212968 GTGCCTCTGGGCTTCTCTCTTGG + Intronic
1020254926 7:6497705-6497727 CAGTGTCTGGGCTGCCCTCTCGG + Intronic
1021612807 7:22474641-22474663 CTGTTGATGGGCTTCTGTCTTGG + Intronic
1022046623 7:26627086-26627108 CTGGGTCTGGGCTTGGCTGTCGG + Intergenic
1023757548 7:43433679-43433701 CTCTTTCTTGGCTTCACTTTAGG - Intronic
1024794143 7:53002906-53002928 CTGTTTCTGGGCTTCACTCTTGG - Intergenic
1026268270 7:68814147-68814169 CTGCTTCTGGGCTCTGCTCCTGG - Intergenic
1026327707 7:69324983-69325005 ATGTTTCTGGGCCTAGGTCTGGG - Intergenic
1027997089 7:85438091-85438113 CTGTCTCTGGGCTCCACACTAGG - Intergenic
1028198588 7:87934810-87934832 CTGCTTCTGGGCCCCGCTCCTGG + Intronic
1033208153 7:139439996-139440018 CTGTTTCTAGGCCTCTCTCCTGG + Intergenic
1034819402 7:154202833-154202855 CAGGTTCTGTGCTTAGCTCTGGG - Intronic
1036912434 8:12768358-12768380 CTCTCTCTGGGCTTCAGTCTTGG - Intergenic
1036918883 8:12832668-12832690 ATTTTTCTGGGCAACGCTCTGGG + Intergenic
1037292265 8:17363725-17363747 CTGTATCTGGGCTTGCCTGTGGG - Intronic
1038145014 8:24887423-24887445 CTGTTCCTGGCCTTGGCTCCTGG - Intergenic
1038656694 8:29459263-29459285 CTGTTGCTGGGTTTCCCTCTAGG + Intergenic
1039424745 8:37476633-37476655 CTGATTCTGGGCTGAGCCCTGGG - Intergenic
1039995174 8:42526070-42526092 CTGTTTCTGTGCTTCCCTCTTGG - Intronic
1040091713 8:43405283-43405305 CTGTTCCTGGGCTTTGTTTTTGG + Intergenic
1042187170 8:66148341-66148363 CTGTATCTGGTCTATGCTCTTGG - Intronic
1042517098 8:69671072-69671094 TGGTTCCTGGGCTTGGCTCTCGG - Exonic
1042629845 8:70804989-70805011 CTGTTTCTAGTCTGCGATCTTGG - Intergenic
1045327798 8:101129565-101129587 CTTTGCCTGGGCTTCTCTCTTGG + Intergenic
1046065603 8:109193425-109193447 CTATGTTTGGGCTTCACTCTTGG + Intergenic
1047552181 8:125886603-125886625 CTATTTTTAGGCTTTGCTCTTGG + Intergenic
1047911326 8:129533149-129533171 CTATTTCTGGGTTTCCATCTGGG - Intergenic
1048101777 8:131359578-131359600 CTGTTTCTAGTCTGCTCTCTGGG + Intergenic
1048502833 8:134994332-134994354 CTGATTCTGGGCTTGGGTCAGGG + Intergenic
1049614796 8:143571439-143571461 CTGATGCTGGGCTCCTCTCTTGG - Intronic
1050333080 9:4564642-4564664 CTGTTTCTTCCCTTCCCTCTTGG - Intronic
1054504382 9:65894873-65894895 CTGTGGCTGGGCTTCCCTCCTGG + Exonic
1054838462 9:69706766-69706788 CTGTTTCTTGGCTTTGCCTTGGG - Intergenic
1056662607 9:88555731-88555753 TTGGTTCTGGGCTTGGCACTGGG + Intronic
1056867095 9:90237623-90237645 CTGTCTCTGGGCTTGGCTGGAGG + Intergenic
1057942174 9:99294812-99294834 CAGGCTCTGGGCTTGGCTCTGGG + Intergenic
1059471224 9:114505703-114505725 CTGTTTCTGAGCCCCGCTCCCGG - Intergenic
1061231002 9:129315769-129315791 CTGATTCTCGGCTGTGCTCTGGG + Intergenic
1062084864 9:134643190-134643212 GTTTTTCTAGGCATCGCTCTTGG + Intronic
1062466212 9:136682768-136682790 CTCTTACGGGGCTTCGCTCGAGG - Intronic
1186123871 X:6392039-6392061 CTTTTTCTGCCCTTGGCTCTTGG + Intergenic
1186404769 X:9292114-9292136 CTGTTTGTGGGCCTCTGTCTGGG - Intergenic
1189299868 X:39944653-39944675 CTGTGTCTGGGTTTCCCTCAGGG - Intergenic
1189698707 X:43693963-43693985 CTGTACCTGGCCTTCACTCTTGG + Intronic
1191829596 X:65402021-65402043 CAGTTTCAGGACTTCACTCTTGG + Intronic
1193400410 X:81036177-81036199 CTGTTTCTGGGCTTTGTTTTGGG - Intergenic
1193545480 X:82821983-82822005 ATGTTTCTGGGCTTTACTTTGGG + Intergenic
1193696006 X:84708290-84708312 CTGTTTCTCGTATTTGCTCTTGG + Intergenic
1195109914 X:101637711-101637733 CTCTTTATGGACTTCGTTCTAGG + Intergenic
1197993983 X:132352479-132352501 TTCTTTCTGGGCTTCAATCTTGG - Intergenic
1199714080 X:150493621-150493643 CTATTTCTAGGGTTGGCTCTTGG - Intronic
1199732575 X:150650944-150650966 CTGTTTCTGGGCCTTTGTCTAGG + Intronic