ID: 1170569444

View in Genome Browser
Species Human (GRCh38)
Location 20:17624725-17624747
Sequence AGCTGGTGTCAGACAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170569439_1170569444 3 Left 1170569439 20:17624699-17624721 CCTGCACTGGCAGCACGGGCTGC 0: 1
1: 0
2: 0
3: 16
4: 249
Right 1170569444 20:17624725-17624747 AGCTGGTGTCAGACAGGACAGGG 0: 1
1: 0
2: 1
3: 28
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170569444 Original CRISPR AGCTGGTGTCAGACAGGACA GGG Intronic
900713762 1:4131002-4131024 AGCTGGTGCCAGGCAGAACTGGG + Intergenic
901457553 1:9371896-9371918 AGCTGCTGGCAGGCAGGACTCGG + Intergenic
902688696 1:18096118-18096140 AGCAGGTGAGAGACAGTACAAGG - Intergenic
903470108 1:23580989-23581011 TATTGGAGTCAGACAGGACAAGG + Intergenic
903577499 1:24347802-24347824 GGCTGCTGTCTGACAGGCCAGGG + Intronic
904044507 1:27601956-27601978 AGTTGGTGTCAGGCGGGACTTGG - Intronic
904286209 1:29454674-29454696 AGATGGTCTCAGAGTGGACAGGG + Intergenic
904384990 1:30135228-30135250 GGCTGGAGTCTGACAGGCCAGGG - Intergenic
904947175 1:34208016-34208038 AGCTGGCCTCAGACAGCCCATGG + Intronic
906081491 1:43092122-43092144 ATCTGGTGTCAGAAGTGACAGGG - Intergenic
906297216 1:44656120-44656142 TGCTGGGGTCAGACAGGTCCGGG + Intronic
907448373 1:54524975-54524997 AGCTGGGGTCTGACTGCACATGG + Intergenic
907968328 1:59355760-59355782 AGCTGGAGGCAGACTGGACTAGG - Intronic
907985750 1:59528416-59528438 AGCTGGGGCCAGACAGACCAAGG - Intronic
909350213 1:74643799-74643821 AGCTAGTGTCAGATAGGCCAAGG - Intronic
910532241 1:88250875-88250897 AGCTGCTGACACACAGGAAAAGG + Intergenic
911332344 1:96540135-96540157 ATCTGGTGTCTGGCAGGAGATGG - Intergenic
911587079 1:99703858-99703880 AGCTGGTGGGAGAAAGGAAATGG - Intergenic
912009461 1:104940916-104940938 AAGTGGTGACAGACAGCACATGG - Intergenic
912261186 1:108112738-108112760 AGCTGGAGTCAGACACAACCAGG + Intergenic
912936974 1:114012212-114012234 GACTGGTGTCTGACTGGACATGG - Intergenic
915341617 1:155179595-155179617 AGCGGGTGTCAGTCAGGGCCTGG - Intronic
919120661 1:193336077-193336099 AGCTGCTGTCTAACAGAACATGG - Intergenic
920387824 1:205580714-205580736 AGTTGGCCTCAGACAGGAAAGGG - Exonic
923956523 1:239028678-239028700 AGCTGATGATAGCCAGGACAAGG - Intergenic
924251697 1:242139719-242139741 TGCTGGAGGCAGACAGGACAGGG + Intronic
1065600060 10:27359097-27359119 AGAAGCTGTCAGTCAGGACAGGG + Intergenic
1066189955 10:33047072-33047094 AGCTGGTGTTATAGAGGCCAAGG + Intergenic
1067761419 10:49050332-49050354 AACAGATGTGAGACAGGACAGGG + Intronic
1068064347 10:52109908-52109930 AAGTGGTGTGATACAGGACATGG - Intronic
1068861921 10:61856043-61856065 AGCTGGAGCCAGACTGCACAGGG + Intergenic
1068875174 10:61988023-61988045 AGCTGATGTAAGACAGGAGGAGG - Intronic
1069062924 10:63913076-63913098 TGATGGTGTCTGACAGGGCATGG + Intergenic
1069403019 10:68069720-68069742 AACTTGTGTCAGAAAGCACATGG - Intronic
1070722161 10:78764327-78764349 AACTGAGGTCAGAGAGGACAGGG - Intergenic
1071515708 10:86295378-86295400 AGGGCGTCTCAGACAGGACATGG + Intronic
1072425202 10:95324234-95324256 CCCTGGAGTCAGGCAGGACAGGG + Intronic
1072524315 10:96258081-96258103 AGCCGGTGCCAGAAATGACAAGG - Intronic
1073006539 10:100329603-100329625 AGCTGGTTTGAGGGAGGACATGG - Intronic
1073068151 10:100776270-100776292 AGCAGGAGCCAGACAGAACAAGG - Intronic
1073247026 10:102098350-102098372 AGCTGGAGCCAGACTGGACAAGG - Intergenic
1075079851 10:119376070-119376092 AGCTGGACTCACACAGGAAAGGG - Intronic
1077168656 11:1156597-1156619 ACCTGGGCTAAGACAGGACATGG + Intergenic
1077202424 11:1317720-1317742 AGCAGCTGTCAGACTGGCCAGGG - Intergenic
1080598025 11:33793023-33793045 AGCTGCAGTCAGACTGGACGCGG + Intergenic
1083719407 11:64596975-64596997 AGCTGGTGTCAGCCAGCGCCTGG - Intronic
1084554877 11:69869580-69869602 AGCAGGTGTTAGCCAGGTCAGGG + Intergenic
1084582135 11:70030609-70030631 AGCTGATGACAGAGAGGACATGG - Intergenic
1084628535 11:70329159-70329181 AAATGGTCTCACACAGGACAGGG - Intronic
1085638705 11:78177757-78177779 AGCGGGTGTCAGAGAGGACTTGG + Intronic
1087056451 11:93941263-93941285 AGTTGGTGTCAGAAATGTCATGG - Intergenic
1087354805 11:97079062-97079084 AGTTGGTGTCATACAGTACCTGG + Intergenic
1087669737 11:101091427-101091449 AGCTGTGGTCACACAGGAGATGG + Intronic
1087810690 11:102606590-102606612 AGCTGGAGTCACAGAGGTCAGGG + Exonic
1088469251 11:110176352-110176374 AGCTGGTGCTAGGCCGGACAAGG - Intronic
1089781596 11:120876915-120876937 AGCAGGAGGCAGACATGACAGGG - Intronic
1090227726 11:125081696-125081718 AGCTGGTGGGAGGCAGCACATGG + Intronic
1090490597 11:127157331-127157353 TGCTGGGGTCAGCCAGGAGAAGG + Intergenic
1090873642 11:130769720-130769742 AGCAGGTGTCAGAAAGAGCAAGG + Intergenic
1091704075 12:2681879-2681901 AGCTGAGCTCAGACAGGAAAAGG + Intronic
1091713598 12:2760388-2760410 AGCTGAGCTCAGACAGGAAAAGG + Intergenic
1092153713 12:6268610-6268632 AGCTGAGGTCAGAGGGGACAGGG + Intergenic
1094395599 12:30002172-30002194 AGCTGGTATCTGACAATACATGG + Intergenic
1097981631 12:65742177-65742199 AGTGGGTGTGAGACAGGAGATGG - Intergenic
1099449247 12:82789035-82789057 AGCTGGTGACAGACAGAAGTAGG - Intronic
1100045417 12:90374628-90374650 AGCTGGTATCATACTGAACAAGG - Intergenic
1100748425 12:97670841-97670863 AGAGGATGTCAGAGAGGACAAGG - Intergenic
1102040368 12:109796925-109796947 AGCTGGAGCCAGACAGAACCTGG + Intronic
1102797316 12:115700110-115700132 AACTGGTGTGATCCAGGACAAGG + Intergenic
1103586976 12:121963353-121963375 ACCAGGGGTCAGACTGGACAAGG + Intronic
1104544545 12:129699408-129699430 AACAGTTGTCAGAAAGGACAGGG - Intronic
1104987724 12:132606306-132606328 ACCAGGTGCCAGGCAGGACAAGG - Intronic
1105209569 13:18249901-18249923 AGGTGGTGTCACTCAGGACCCGG + Intergenic
1105305681 13:19167224-19167246 AGCTGATATCAGACAGCCCAAGG + Intergenic
1106962487 13:35014984-35015006 GGTTGGTGTCACTCAGGACAGGG + Intronic
1107968107 13:45615465-45615487 AGCAGATGTCAGAAAGGCCAAGG + Intronic
1108281720 13:48868303-48868325 AGCTGGAGTCATACACTACAAGG - Intergenic
1110435067 13:75470004-75470026 AGTAGGTTTCAGAAAGGACATGG + Intronic
1110464779 13:75788802-75788824 AGCTGGTGCCACCCAGGGCAGGG + Intronic
1112381017 13:98890276-98890298 AGCTAGTGTCAGTCTGGAAATGG - Intronic
1113809805 13:113131802-113131824 AGCTGTTGACAAACAAGACAAGG + Intronic
1114639135 14:24207353-24207375 TCCAGGTGTCAGACAGGAAAGGG - Exonic
1118076323 14:62303152-62303174 AGCTGGGGTAAGTCAGGCCAGGG - Intergenic
1118181020 14:63493369-63493391 ATCTAGTGGCAGACAGGCCAGGG - Intronic
1120716383 14:87845343-87845365 AACTGGAGTCAGACAGAACTTGG + Intronic
1121432547 14:93898185-93898207 TGCTGGGGTCAGAGAGGCCAGGG + Intergenic
1122898021 14:104769952-104769974 AGCTGGTGACAGACAGCCCAGGG + Exonic
1123039780 14:105485771-105485793 GACTGGTGGCAGACAGGGCAGGG + Intergenic
1123806227 15:23876893-23876915 GGCTAGTGTGAGTCAGGACATGG - Intergenic
1124650296 15:31469214-31469236 AGCAGGTGCCAGAGAGGAGAGGG + Intergenic
1125472283 15:40015950-40015972 AGCTGGTGACAGCCAGGATCTGG + Intronic
1125607512 15:40949592-40949614 AACTTGTGTTACACAGGACATGG + Intergenic
1132315751 15:100889258-100889280 GGAGGGTGTCAGCCAGGACACGG + Intronic
1132573964 16:656348-656370 AGGAGGTGGCAGACAGCACACGG - Exonic
1132930732 16:2457979-2458001 AGTTGGGATCAGCCAGGACACGG - Exonic
1133140773 16:3742202-3742224 AGGTGGTCTCAGACAGCACAGGG + Intronic
1133724056 16:8521074-8521096 TGCTGGTGTCTGACAGGCCAAGG - Intergenic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1134689002 16:16178764-16178786 AACATGTGTCAGACAGTACAGGG - Intronic
1135198873 16:20419381-20419403 TGCTGGTGTCAGACAGCAGTCGG + Exonic
1135219814 16:20604294-20604316 TGCTGGTGTCAGACAGCAGTCGG - Intergenic
1138181897 16:54946241-54946263 AGCTGGTGTCAGACAGATGTGGG + Intergenic
1138456189 16:57122117-57122139 CGCTGATGCCAGAGAGGACAGGG - Intronic
1139268597 16:65661841-65661863 AGCTAGTGGCTGGCAGGACAAGG + Intergenic
1140690451 16:77478406-77478428 AGATGGTGCCAGCCAGGACAAGG - Intergenic
1141376209 16:83533183-83533205 AGCTGGTGTCACGCTGGAGAAGG + Intronic
1142003824 16:87679766-87679788 AACTGGGGTAAGAGAGGACACGG - Intronic
1142428975 16:90016301-90016323 AGAGGGTGTCAGACAGGCCTGGG - Intronic
1142582763 17:952244-952266 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582782 17:952308-952330 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582801 17:952372-952394 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582820 17:952436-952458 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582839 17:952500-952522 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582875 17:952628-952650 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582892 17:952692-952714 GGCTGGAGTCAGACAGACCAAGG + Intronic
1142582910 17:952757-952779 GGCTGGAGTCAGACAGACCAAGG + Intronic
1142582927 17:952821-952843 GGCTGGAGTCAGACAGACCAAGG + Intronic
1142780481 17:2177579-2177601 AGCTGGTATTACACAGGAAATGG - Intronic
1150220813 17:63494952-63494974 GGCTGGGGTCAGACAGAACTGGG + Intronic
1150306310 17:64088262-64088284 AGATGGGGTCAGAAAGAACAAGG - Intronic
1151514382 17:74582769-74582791 AGCTGCTGGAAGACAGGAAACGG - Intronic
1151535265 17:74735801-74735823 AGCTGATGTCAGAAAATACAGGG + Intronic
1151552670 17:74831092-74831114 AGCAGGTGTCAGACGGGACGTGG - Intronic
1153967219 18:10192725-10192747 AACTGGAAACAGACAGGACACGG - Intergenic
1154305223 18:13225531-13225553 AGCTGTTGACAGAGTGGACAGGG - Intronic
1156675232 18:39520075-39520097 AGTTGTAGTCAGAGAGGACAAGG - Intergenic
1156687633 18:39669132-39669154 AGCTGGTCTATGAAAGGACAAGG + Intergenic
1156839159 18:41590914-41590936 AGCTGGTGTCAGCTATAACATGG - Intergenic
1158375135 18:56854817-56854839 AGCTGGTGAAAGAGAGGGCAGGG + Intronic
1158873616 18:61711954-61711976 TGCTGTTGTCAGTCAAGACAAGG + Intergenic
1161636615 19:5393292-5393314 AGTTGGGGTCAGAGAGGCCATGG - Intergenic
1161745635 19:6058030-6058052 TCCTGGTGCCAGAAAGGACATGG - Intronic
1163200197 19:15761159-15761181 AGAAGGTGGCAGTCAGGACAAGG + Intergenic
1163314931 19:16535349-16535371 AACAGGTGTCAGTGAGGACAGGG - Intronic
1165782271 19:38441539-38441561 AGCTGGAGTCTGAGAGGGCAGGG + Intronic
1166138205 19:40790251-40790273 AGATGGTGGAGGACAGGACAAGG + Intronic
1167601480 19:50457525-50457547 TGCTGGAGTCAGACAGGCCTGGG + Intronic
925069505 2:955890-955912 AGCTGGTGCCAGGGAGGCCAAGG + Intronic
925346046 2:3172711-3172733 ATCTGGAGTCAGACAGGCCTGGG - Intergenic
925896155 2:8473813-8473835 GGCTGGTGCCAGCCAGGACCTGG - Intergenic
926063937 2:9822266-9822288 AGCTGGCGTGAGTCAGGGCATGG + Intergenic
926122891 2:10254443-10254465 AGCTGGTCTAACTCAGGACACGG + Intergenic
927459658 2:23287091-23287113 AGCTGGTTCCAGATAAGACATGG + Intergenic
927547901 2:23970977-23970999 ACCTGGTTTCTGACAGGCCATGG + Intronic
928088780 2:28361517-28361539 AGCTGTTCTCAGAAAGGACAGGG + Intergenic
928387762 2:30884492-30884514 GGCTGGTGCCAGACAGGGCCAGG - Intergenic
929037793 2:37711379-37711401 TGCTGGTGATAGAGAGGACAAGG - Intronic
929594555 2:43168166-43168188 CCCTGGTGTCAGACAGGACCTGG + Intergenic
931167322 2:59762072-59762094 AGCTTGTGTCAGAGAGGTCTTGG - Intergenic
932446814 2:71786589-71786611 TGCTGGTGTCAGTCATGACCAGG + Intergenic
932791153 2:74655104-74655126 AGCTGCTGTCAGAGATGTCAGGG - Intronic
933834016 2:86231517-86231539 AGATGGGGTCTGTCAGGACATGG + Intronic
934584127 2:95474755-95474777 TGCTGGTCTCAGACAGAACAGGG + Intergenic
934595325 2:95601959-95601981 TGCTGGTCTCAGACAGAACAGGG - Intergenic
938809575 2:134840672-134840694 AGCTGGTGATAGAAAGGAGAGGG - Intronic
939329074 2:140735111-140735133 AGCAGTTGTCAAAGAGGACACGG + Intronic
942345118 2:174994814-174994836 AGATGAAGTCAGACAGGTCAAGG + Intronic
942497871 2:176558700-176558722 AGCTGGACTCAGAAAGGAAATGG + Intergenic
948671976 2:239574637-239574659 AGCTGGAGACAGCCAGGGCAAGG - Intergenic
948943465 2:241207764-241207786 AGCTGGTGACAAGCAGGACAGGG - Intronic
949075457 2:242055002-242055024 AGCTGATGTCAGAGGAGACAAGG + Intergenic
1169608585 20:7352473-7352495 AGCTTGTGACACGCAGGACATGG + Intergenic
1170163089 20:13335858-13335880 AGTTGGAGGCAGACAGAACAGGG + Intergenic
1170301416 20:14888303-14888325 AGCTGCTGAGAGACAGGAAATGG + Intronic
1170569444 20:17624725-17624747 AGCTGGTGTCAGACAGGACAGGG + Intronic
1171290725 20:23981568-23981590 AGGTGGTGTCACTCAGGACCCGG + Intergenic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1172648457 20:36486439-36486461 AGTTAGTTTCAGACAGGGCATGG + Intronic
1172795959 20:37537765-37537787 AGCTGGAGTCAGCCAGGTGAAGG - Intergenic
1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG + Intergenic
1175428429 20:58886267-58886289 AGATGGTGTCACACACTACATGG - Intronic
1175699217 20:61125085-61125107 AGCTAGTGTAAGCCAGGAGAAGG + Intergenic
1178894822 21:36549639-36549661 AGCTGCTGTCAGAAAGATCACGG + Intronic
1179141324 21:38727959-38727981 AGCTGATGTCAGACTGGATTTGG + Intergenic
1179788846 21:43744028-43744050 GGCTGGTGTGAGACAGGAAGGGG + Intronic
1179842229 21:44084677-44084699 AGCTGGCGTCAGACACCACAGGG + Intronic
1179982950 21:44905926-44905948 AGCTGGTGTCGGACAGGCTGGGG - Intronic
1180766697 22:18349499-18349521 AGGTGGTGTCACTCAGGACCCGG - Intergenic
1180779617 22:18512879-18512901 AGGTGGTGTCACTCAGGACCCGG + Intergenic
1180812332 22:18770200-18770222 AGGTGGTGTCACTCAGGACCCGG + Intergenic
1181179102 22:21054859-21054881 AGCTGGTGTCCACCAGGACAGGG + Intronic
1181198489 22:21204447-21204469 AGGTGGTGTCACTCAGGACCCGG + Intergenic
1181401249 22:22651352-22651374 AGGTGGTGTCACTCAGGACCCGG - Intergenic
1181437194 22:22917858-22917880 AGCTGGTGTCAGGAATGCCAGGG - Intergenic
1181703215 22:24632434-24632456 AGGTGGTGTCACTCAGGACCCGG - Intergenic
1182028534 22:27139030-27139052 AGATGCTGTCACAGAGGACAGGG + Intergenic
1182107227 22:27698182-27698204 AGCAGGACTCAGACAGAACAGGG + Intergenic
1182144050 22:27985946-27985968 AGCAGGTGTAACACAGGGCATGG + Intronic
1182736525 22:32535153-32535175 AGCTGGAATCAGACAGGATCTGG - Intronic
1182778865 22:32851408-32851430 TGCTGGTGTCAGACCAGCCACGG + Intronic
1183219648 22:36504422-36504444 AGCTGGGGTCAGGAAGGGCAGGG + Intronic
1183589033 22:38769357-38769379 AGATGAGGTCAGAGAGGACAGGG + Intronic
1184263326 22:43332398-43332420 GGCTGGTCTGAGACAGGACCTGG - Intronic
1184528095 22:45037287-45037309 AGCTGGTGTGAGACTGACCATGG - Intergenic
1185041784 22:48507913-48507935 AGCTGGTGTGGGCCAGGCCAGGG - Intronic
1185046049 22:48529268-48529290 TGAGGGTGTCAGACAGGAGATGG + Intronic
1185232774 22:49693017-49693039 AGCTGCTGTCACAAAGGACCCGG + Intergenic
1203228316 22_KI270731v1_random:90390-90412 AGGTGGTGTCACTCAGGACCCGG - Intergenic
950531705 3:13556100-13556122 AGCTGGGGGCACAGAGGACATGG - Intronic
952310741 3:32186974-32186996 AGCTGGGGGCAGGGAGGACAAGG - Intergenic
952823561 3:37506109-37506131 AGCTGGGGTCAGACAGAAGAGGG + Intronic
955112265 3:55960676-55960698 AGCTTGGGCCAGAGAGGACATGG - Intronic
956726501 3:72160903-72160925 AGCTGGTGTCAGAAGGGTCCAGG + Intergenic
959473452 3:106781740-106781762 AGCTGGTGACAGCCAGGAGCTGG + Intergenic
959479045 3:106848870-106848892 AGTTGGTGTCAAACAGGATGTGG - Intergenic
959779561 3:110212678-110212700 AGCTAGTATCATACTGGACAGGG + Intergenic
961311906 3:126007665-126007687 AGCTGGGGTTAGCCTGGACAAGG - Intronic
961537426 3:127578669-127578691 AGATGGTGGTAGACAGGACTGGG - Intronic
962084179 3:132173392-132173414 AGCTGGTGTCAGACTGCTCTGGG - Intronic
962345698 3:134617820-134617842 AGGTGGTGTCACACAGTGCAGGG + Intronic
962812777 3:138973433-138973455 AGCTGGTGTCTGACACAAAAAGG - Intergenic
964800997 3:160557227-160557249 AACAGGTGGCAAACAGGACAGGG + Intronic
966624446 3:182001135-182001157 AGCTGGGGTCAGACGGGAACAGG + Intergenic
967677877 3:192321851-192321873 AGCTGGTATCATACTGAACAAGG + Intronic
967979939 3:195059710-195059732 AGTTTGGGTGAGACAGGACAGGG - Intergenic
968452858 4:683322-683344 AGCAGGTGGCAGCCAGGGCAAGG + Exonic
969308475 4:6338881-6338903 AGCTGGGCTCAGAGAGGACCAGG - Intronic
969602804 4:8187024-8187046 GGCAGGTGTCAGAGAGGGCAAGG - Intronic
970715932 4:18922897-18922919 AGCTGATGTCAGAGATGGCAGGG + Intergenic
971225948 4:24751747-24751769 AGTTGGTGTTAGGCAGGCCAAGG - Intergenic
973942032 4:55920822-55920844 AGCTGAAGTCAGACAAGCCAGGG - Intergenic
976151883 4:82100485-82100507 CTCTGGGGGCAGACAGGACAAGG + Intergenic
979912886 4:126392312-126392334 AGCTAGTATCATACAGAACAGGG - Intergenic
980493523 4:133560856-133560878 AGCTGGTGTGAGCCAGGATCAGG - Intergenic
981628364 4:146787861-146787883 AGCTGGTGACCGACAGGAGGAGG - Intronic
982811723 4:159833866-159833888 AGCTGATGTCAGAGAGAAAATGG - Intergenic
983219029 4:165026814-165026836 TGGTGGAGGCAGACAGGACAAGG + Intergenic
983328321 4:166289375-166289397 AGCAGGTGTCTTACAGGGCAGGG + Intergenic
984118778 4:175715600-175715622 AGCTTGTGTCAGACTAAACATGG - Intronic
984847819 4:184122534-184122556 TGCTGGTGTCTCTCAGGACAGGG + Intronic
986085640 5:4442401-4442423 AGCTGGAGACAGACAGGATGTGG + Intergenic
986280619 5:6319144-6319166 AGTGGATGTCAGACAGGAGATGG + Intergenic
987033238 5:13994994-13995016 AGCTTGTCACAGACAGGACCTGG + Intergenic
987230993 5:15893173-15893195 AGCTGGGGAGAGGCAGGACAGGG + Intronic
988491748 5:31711098-31711120 AGCTGGGGTCAGACAGCTAAAGG + Intronic
988961281 5:36374022-36374044 AGATGATGTCAGACAGGGTATGG + Intergenic
990684692 5:58288292-58288314 AAGTGGTGACAGACAGCACATGG + Intergenic
992000153 5:72428475-72428497 AGCTAGTGTAAGACAGAACCAGG + Intergenic
992571547 5:78064547-78064569 AGCAGCTATCAGACATGACATGG - Intronic
993595352 5:89847911-89847933 AGCTGCTCTGGGACAGGACAAGG + Intergenic
993659439 5:90613407-90613429 AGCATGTGTGAGACAGGAAAGGG - Intronic
993665842 5:90694576-90694598 AGCTGATGATACACAGGACAGGG + Exonic
994229022 5:97291837-97291859 AGCTAGTATCATACAGAACAGGG - Intergenic
996690680 5:126336758-126336780 AGCTGTTGTGAGAAAGGAAAAGG - Intergenic
997259846 5:132457340-132457362 AGCTGGGACAAGACAGGACATGG - Intronic
999132468 5:149294890-149294912 ATGTGGGGTCAGACAGGCCAGGG + Intronic
999432146 5:151533571-151533593 TGCTGGTGTCAAACAGAGCAGGG + Intronic
1000391883 5:160730946-160730968 ACCAGGTCTCAGAAAGGACAGGG - Intronic
1000537361 5:162495310-162495332 AGATGGTGTCAGACTACACAGGG - Intergenic
1002182866 5:177440590-177440612 TGCTGGTGTCAGGCAGCACTAGG + Intronic
1003395260 6:5747517-5747539 AGCATATGGCAGACAGGACAGGG - Intronic
1003745240 6:8993714-8993736 AGCTGGTGTCAAAAATGAAAAGG - Intergenic
1003885902 6:10521149-10521171 AGCTGGTGTCAGGTAGCACCTGG + Intronic
1005821951 6:29605930-29605952 AGCTGCTGTCAGTCAGGCAAGGG + Intronic
1006879162 6:37323847-37323869 AGCTGGTGTGAGAAAGGGCACGG + Intronic
1007173164 6:39878655-39878677 AGCAGGTGTCGGAGAGGCCAAGG + Intronic
1007425669 6:41744445-41744467 AGCCGGTGTCAAAAAGGACCAGG + Exonic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1014112057 6:117629283-117629305 ATCTGGTGTTAGACACTACAGGG - Intergenic
1015480386 6:133701917-133701939 AGCTCATGTCCAACAGGACATGG - Intergenic
1016041285 6:139434187-139434209 AGCTGGTGGCAGAGAAGATAGGG - Intergenic
1017313447 6:153001766-153001788 CGCTGGTGGCTGACAGGCCAGGG - Intronic
1017918796 6:158853995-158854017 AGCTGGGGTCTGAGAGGCCATGG + Intergenic
1017988349 6:159464239-159464261 GTCTGGTGTCAGCCAGGAAAGGG + Intergenic
1018915514 6:168130292-168130314 AGCTGGAGTCAGACCAGCCAGGG - Intergenic
1019896918 7:3989959-3989981 CTCTGGAGTCAGACAGCACAGGG - Intronic
1020440581 7:8212682-8212704 AGCTGGTGTCAGCAAGGGCGGGG + Intronic
1023117949 7:36880945-36880967 AGATGGTGTCATACAAGTCAAGG - Intronic
1024075598 7:45816357-45816379 AGGTGGGGTCAGACAGGGCTGGG + Intergenic
1024283494 7:47738012-47738034 ACATGGTCTCAGACAGGGCAGGG - Intronic
1025051855 7:55739436-55739458 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025128813 7:56365104-56365126 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025177194 7:56807985-56808007 AGGTGGGGTCAGACAGGGCTGGG - Intergenic
1025694598 7:63768401-63768423 AGGTGGGGTCAGACAGGGCTGGG + Intergenic
1026058169 7:67003310-67003332 ATCTGCTGACAGACTGGACATGG - Intronic
1026929640 7:74216719-74216741 AGCAGGACTCAGACAGGACTTGG - Intronic
1029336904 7:99908839-99908861 AGCTGGGGTCAGGCAGAAAAAGG - Intronic
1030223815 7:107126606-107126628 AGCTGTTCTCAGAAAGGAAAGGG - Intronic
1030825807 7:114156201-114156223 AACTGGTGGCAGACAGCACCAGG - Intronic
1031011799 7:116532393-116532415 AGCTGGTCTCTAAGAGGACAGGG + Intronic
1032574784 7:133041780-133041802 AGATGGGGACAGCCAGGACAGGG - Intronic
1033149477 7:138900723-138900745 AGCTGGTGTTAGAAAGGGCCTGG + Intronic
1033658595 7:143389058-143389080 TGCTGTTTACAGACAGGACATGG - Intronic
1034627524 7:152504785-152504807 TGCTGGTGTCAGCCAGGACTTGG + Intergenic
1035898763 8:3434984-3435006 AGCTGGTAGCAGACAGGACAGGG + Intronic
1035898767 8:3435007-3435029 AGCTGGTAGCAGACAGGACTGGG + Intronic
1036640953 8:10583420-10583442 AGCAGGTGTCAGACAGGGCCTGG - Intergenic
1037154048 8:15677693-15677715 AGGTGGTGTCAGACAGAGCCAGG + Intronic
1037662454 8:20939530-20939552 AGCAGGTGCCAGGCAGGCCAGGG + Intergenic
1041835167 8:62203998-62204020 AGCTGGTGTTATACAGCACTGGG + Intergenic
1042670379 8:71256424-71256446 GGCTGGTTTCACTCAGGACAAGG - Intronic
1042870965 8:73399141-73399163 ACCTGGTGTCAGAGAGGAAGTGG + Intergenic
1043909090 8:85839706-85839728 ACGTGGTGGCAGACAGGAGAAGG - Intergenic
1045046662 8:98285404-98285426 GACTGGTATGAGACAGGACATGG + Intronic
1047822539 8:128537246-128537268 AGCCAGAGTCAGACAGAACAAGG + Intergenic
1049393373 8:142383264-142383286 AGCTGGAGAAAGACAGGCCAGGG + Intronic
1049424471 8:142532005-142532027 ACCTGGAGTCTGCCAGGACAAGG - Intronic
1049614696 8:143571011-143571033 GGCTGGTGTGAGACAAGAGATGG + Intronic
1049669016 8:143861310-143861332 CGCTGGGGTCGGCCAGGACACGG + Exonic
1049669431 8:143862912-143862934 CGCTGGGGTCGGCCAGGACACGG + Exonic
1049669842 8:143864505-143864527 CGCTGGGGTCGGCCAGGACACGG + Exonic
1049670258 8:143866113-143866135 CGCTGGGGTCGGCCAGGACACGG + Exonic
1050102286 9:2131550-2131572 ACCTGGTGACAGACTGGTCAAGG - Intronic
1050305733 9:4304476-4304498 AGTGGGTGTCAGACAGGAGAGGG - Intronic
1051812876 9:21070178-21070200 AGCTTGTGTCAGACTTGAGAGGG + Intergenic
1053449396 9:38180481-38180503 AGCTGCTGTGTGACAGGACTGGG + Intergenic
1055598814 9:77893899-77893921 AGAAGGTGTCAGACAAGACTGGG - Intronic
1056002091 9:82228095-82228117 AGCTTGCCTGAGACAGGACAGGG - Intergenic
1056409696 9:86312819-86312841 AGCAGGTTTCAGAGAGCACAGGG - Intronic
1056581948 9:87895028-87895050 TGCTTTTGTCAGACAGGAAATGG + Intergenic
1056630323 9:88288073-88288095 AGCTGGGGTCAGCCAGCACAAGG + Intergenic
1057971956 9:99567148-99567170 AGCTGGTGTGAGAGATCACATGG - Intergenic
1058781056 9:108335976-108335998 TGGTGGTGCCAGACAGGAGAGGG - Intergenic
1060137779 9:121173887-121173909 AGTTGGTGTCACACAGTAAATGG + Intronic
1061812443 9:133170221-133170243 TGCTGGTGTCAGATCAGACACGG + Intergenic
1062173238 9:135147043-135147065 AGCCTGGGTCAGACAGCACAGGG + Intergenic
1062630450 9:137460904-137460926 AGCTGGAGCCAGACAGAACCAGG - Intronic
1203691681 Un_GL000214v1:48136-48158 AGCTGGTGGGAGTCAGGAAAGGG - Intergenic
1203644614 Un_KI270751v1:56055-56077 AGCTGGTGGGAGTCAGGAAAGGG + Intergenic
1186959113 X:14715757-14715779 AGTAGGTGTAAGGCAGGACATGG + Intronic
1187036883 X:15549776-15549798 AGCTGTTATCAGAAAGTACAGGG - Intronic
1187563661 X:20426932-20426954 AGCAGGTGTATGACAGGCCAGGG + Intergenic
1189244364 X:39552165-39552187 AGCTGGAGTCACACAGCCCAAGG - Intergenic
1192600189 X:72454270-72454292 CCCTGGTGGCAGACAGGAAATGG + Intronic
1192892115 X:75401116-75401138 AGCTGGGGTCTGACTGCACATGG + Intronic
1195621295 X:106958206-106958228 AGCTGGGGTCAGTCAGCACAGGG + Intronic
1196874603 X:120146329-120146351 AGGTGGTGATAGAGAGGACAGGG - Intergenic
1197863273 X:130992608-130992630 ATCTGGAGTCACACAGGCCAAGG - Intergenic
1198034121 X:132783965-132783987 AGCTGGAATCAGGCAGGAGAGGG + Intronic
1198379829 X:136073536-136073558 AGAAGGTGTGAGACAGGAAAAGG - Intergenic
1198512190 X:137363541-137363563 AGCGGGTGTCAGAAAGCACAGGG - Intergenic