ID: 1170570158

View in Genome Browser
Species Human (GRCh38)
Location 20:17628095-17628117
Sequence CTCGACTGTGAAGAGGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170570158_1170570165 -10 Left 1170570158 20:17628095-17628117 CCCAAGACCTCTTCACAGTCGAG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1170570165 20:17628108-17628130 CACAGTCGAGAAAGGCCAGGGGG No data
1170570158_1170570167 7 Left 1170570158 20:17628095-17628117 CCCAAGACCTCTTCACAGTCGAG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1170570167 20:17628125-17628147 AGGGGGTGACTCTTCTGCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 937
1170570158_1170570171 27 Left 1170570158 20:17628095-17628117 CCCAAGACCTCTTCACAGTCGAG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1170570171 20:17628145-17628167 TGGGCCCCTTTCTCCCCTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 226
1170570158_1170570168 8 Left 1170570158 20:17628095-17628117 CCCAAGACCTCTTCACAGTCGAG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1170570168 20:17628126-17628148 GGGGGTGACTCTTCTGCCCTGGG 0: 1
1: 1
2: 1
3: 13
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170570158 Original CRISPR CTCGACTGTGAAGAGGTCTT GGG (reversed) Intronic
901684482 1:10936021-10936043 CTCTACTGTGCAGAGGCCTTGGG + Intergenic
903348569 1:22703809-22703831 CTGGTCTGTGATGAGGTCTTTGG + Intergenic
905773537 1:40653730-40653752 GGCGACTGGGAAAAGGTCTTTGG + Intronic
907475734 1:54704112-54704134 CTGGACTGAGAAAAGCTCTTTGG + Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
912551283 1:110487055-110487077 GTAGACTGAGAACAGGTCTTGGG - Intergenic
913595103 1:120367898-120367920 CTAAACTGAGAAGACGTCTTTGG - Intergenic
913777737 1:122343400-122343422 CTCCTCTGTGAAGATTTCTTTGG + Intergenic
914092168 1:144511087-144511109 CTAAACTGAGAAGACGTCTTTGG + Intergenic
914595682 1:149150024-149150046 CTAAACTGAGAAGACGTCTTTGG + Intergenic
915571031 1:156745110-156745132 CTCGTAAGGGAAGAGGTCTTTGG + Exonic
918219436 1:182423092-182423114 CTGGGCTGTGAAGAGGTCTTAGG + Intergenic
919310127 1:195896419-195896441 CTAGCCTGTGAAAAGGCCTTAGG - Intergenic
921746990 1:218750962-218750984 CATGACTGTGTAGAGGTGTTGGG - Intergenic
1062826857 10:576290-576312 CTCGAGTGTGATGTGGTCTGTGG - Intronic
1067109876 10:43392753-43392775 GTCCACTGAGAAGAGGACTTGGG - Intronic
1067780851 10:49205878-49205900 ATGGACTCTGAATAGGTCTTCGG + Intergenic
1070159604 10:73858260-73858282 CTCGACTGTGCACTGTTCTTGGG + Intronic
1070398182 10:76031160-76031182 CTGGATTATGAAGAGGTCTGGGG + Intronic
1075899721 10:126031082-126031104 GAGGACTGTGGAGAGGTCTTAGG + Intronic
1077413018 11:2412236-2412258 CTCGTCTGTGAAGAAGCCCTGGG + Exonic
1080168061 11:29264211-29264233 CTCAACTGTGAGGTAGTCTTGGG + Intergenic
1081228156 11:40551041-40551063 CCTGACTGGGAAGAGGTGTTAGG - Intronic
1083192721 11:61063916-61063938 CTCAGCTGTGGAAAGGTCTTGGG + Intergenic
1085278280 11:75313993-75314015 CCAGATTGTGAAGAGCTCTTGGG - Intronic
1089026247 11:115273262-115273284 CTAGACAGTGATGATGTCTTAGG - Intronic
1089332437 11:117699338-117699360 CTCGAATGTGAAGAGGAGTTAGG + Intronic
1091248319 11:134119215-134119237 CACGACTGGCAAGAAGTCTTTGG + Intronic
1092666479 12:10805387-10805409 CCAGATTGTGAAGAGGGCTTAGG + Intergenic
1104651539 12:130538275-130538297 TTCCACTGTGAAGAGCTTTTGGG - Intronic
1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG + Intergenic
1107062436 13:36174132-36174154 CTCCATTGTGGAGAGGTCTCGGG - Intronic
1107548813 13:41457189-41457211 CTCGGCTGTGAAGTGGACGTGGG - Intergenic
1107730761 13:43346155-43346177 CTGGTCTGGGAGGAGGTCTTTGG - Intronic
1112217659 13:97450428-97450450 CTCGAAGGGGAAGAGGTATTCGG - Intronic
1114664120 14:24368448-24368470 CTGGGCTGGGAAGGGGTCTTGGG + Intronic
1118037332 14:61882360-61882382 CTGCCCTGTGAAGAAGTCTTGGG - Intergenic
1119601016 14:75977052-75977074 CTCTACTGTGCAGAGGGCATTGG + Intronic
1120802539 14:88707840-88707862 CTTGCCTGTCAAGAGGGCTTTGG + Intronic
1124074624 15:26433187-26433209 CTTGACTGTGATGAGGACTGTGG - Intergenic
1124075129 15:26436999-26437021 CTCAACTGTGATGAGGACTGTGG + Intergenic
1140867109 16:79072329-79072351 CTCAACTCTGCAGAGGTCCTGGG + Intronic
1152613145 17:81325445-81325467 CCCGACTGTGCAGAGGTGGTAGG + Intronic
1152938584 17:83154192-83154214 CTCGACTGGGAAGGGGGCGTGGG - Intergenic
1155821768 18:30386782-30386804 CTACACTGTGGAGAGGTCTGTGG + Intergenic
1162774418 19:12970300-12970322 GTGGGCTGTGAAGAGGACTTGGG - Intronic
925603790 2:5637241-5637263 CTAAACTGAGAAGAGGTCTTTGG - Intergenic
925657946 2:6169483-6169505 CTCGACTGTGAAAATGTCTTTGG - Intergenic
926252274 2:11161895-11161917 CTCCACTCTGAAGAGGGCATGGG - Intronic
928800057 2:35078622-35078644 CTAGAGTGTGAAGAGGTTTCTGG + Intergenic
932133166 2:69205440-69205462 CTTGACTGGGAGAAGGTCTTGGG - Intronic
936469573 2:112786769-112786791 CTCGACTCTGAGGAGGCCTCAGG + Intergenic
943090663 2:183370768-183370790 CTCCACTGTGATGAAGTGTTTGG - Intergenic
944473473 2:200080373-200080395 CTCCACTGTGAAGACTTCCTTGG + Intergenic
945148176 2:206760491-206760513 CTTTACTGGGAAGTGGTCTTGGG - Intronic
947352959 2:229265535-229265557 CTAGACTTTAAGGAGGTCTTTGG + Intronic
1170570158 20:17628095-17628117 CTCGACTGTGAAGAGGTCTTGGG - Intronic
1170791880 20:19515503-19515525 CTCGTTTGTGAAGATGTCATTGG - Exonic
1171972390 20:31572595-31572617 CTCGACTGTGAAGGGGGGTTAGG + Intronic
1173331209 20:42077698-42077720 CAGGACAGTGAATAGGTCTTAGG - Exonic
1181138583 22:20786960-20786982 GTCGACAGTGAAGCGGACTTGGG - Exonic
954837933 3:53486981-53487003 CTAGAATGTGAAGAACTCTTAGG + Intergenic
957695475 3:83633692-83633714 CTGGGCTGTGAAGTGGACTTAGG - Intergenic
958262358 3:91396413-91396435 CTCAACTGCAAAGATGTCTTTGG - Intergenic
964639349 3:158892181-158892203 CTCCACTGTGAAGTTGCCTTAGG + Intergenic
965773640 3:172207049-172207071 CTCTTCTGTGATGAGCTCTTTGG - Intronic
966064107 3:175795934-175795956 CTCTGCTGTGAAGTTGTCTTGGG + Intronic
974239516 4:59228451-59228473 CTCTTCTGTGAAGAGGTTTTAGG - Intergenic
978246915 4:106583971-106583993 CTTGACTGTGAAAATATCTTAGG + Intergenic
984692176 4:182739526-182739548 CTTGACTTTGCAGAGGTTTTTGG + Intronic
988108209 5:26777425-26777447 CTAGACTATGAATGGGTCTTAGG + Intergenic
995731492 5:115247844-115247866 CTGAACTGTGAAAAGGTCTGTGG + Intronic
1008993059 6:57626464-57626486 CTCAACTGCAAAGATGTCTTTGG + Intronic
1011255724 6:85418796-85418818 CTGGACTGTGAGGAGGGCTAGGG + Intergenic
1021193506 7:17648990-17649012 CTCAAGTGAGCAGAGGTCTTTGG - Intergenic
1034681506 7:152931996-152932018 CTTGAATGTAAAGAGCTCTTGGG + Intergenic
1040945000 8:52874722-52874744 ACAGACTGAGAAGAGGTCTTAGG - Intergenic
1045871258 8:106929891-106929913 CTCAACTGGGAAGGGGTCTGAGG - Intergenic
1050068421 9:1785618-1785640 CTAGACAGAGAAGAGGTCTCAGG - Intergenic
1056885274 9:90436650-90436672 CTTTACTGTGAAGAGGGCTAGGG - Intergenic
1057020101 9:91690755-91690777 CTCCACTGTGAAGCTGTCCTGGG - Intronic
1059307093 9:113362437-113362459 GTGGAGTGTGAAGAGGTCTAAGG - Intronic
1190257807 X:48776856-48776878 GTCCACTGTGAATAGGTGTTAGG - Intergenic
1190527415 X:51342049-51342071 CTCTACAGTGAAGAAGTCTCAGG + Intergenic
1191998613 X:67123977-67123999 CTGGAGGGTGAAGAGGGCTTTGG + Intergenic
1195393505 X:104387293-104387315 CTGGTCTGTGAAGAAGTCTATGG + Intergenic
1195699114 X:107689097-107689119 CTGGAGTGAGAAGAGGTCTGAGG + Intergenic
1198482924 X:137057285-137057307 CTCTACAGTGAAGAACTCTTTGG + Intergenic
1202381242 Y:24277710-24277732 ATGGAGTGTGAAGAGGGCTTTGG - Intergenic
1202489543 Y:25392416-25392438 ATGGAGTGTGAAGAGGGCTTTGG + Intergenic