ID: 1170571322

View in Genome Browser
Species Human (GRCh38)
Location 20:17634422-17634444
Sequence GCCACACCAAAGCCCACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170571320_1170571322 -4 Left 1170571320 20:17634403-17634425 CCTCGTCTGTACCGGGGAGGCCA No data
Right 1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG 0: 1
1: 0
2: 1
3: 16
4: 170
1170571314_1170571322 19 Left 1170571314 20:17634380-17634402 CCACCTCTCTGACTTGGGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 297
Right 1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG 0: 1
1: 0
2: 1
3: 16
4: 170
1170571313_1170571322 20 Left 1170571313 20:17634379-17634401 CCCACCTCTCTGACTTGGGGGCT 0: 1
1: 0
2: 0
3: 17
4: 209
Right 1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG 0: 1
1: 0
2: 1
3: 16
4: 170
1170571315_1170571322 16 Left 1170571315 20:17634383-17634405 CCTCTCTGACTTGGGGGCTGCCT 0: 1
1: 0
2: 2
3: 20
4: 227
Right 1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170571322 Original CRISPR GCCACACCAAAGCCCACTGT AGG Intronic
900409425 1:2506106-2506128 GCCACACCCACTCCCACTGTTGG - Intergenic
900559278 1:3295676-3295698 GACTAAACAAAGCCCACTGTGGG - Intronic
901293078 1:8139851-8139873 CCCACACCATCCCCCACTGTTGG - Intergenic
901655830 1:10768645-10768667 GCCCAGCCAGAGCCCACTGTGGG + Intronic
903827553 1:26156665-26156687 TCCACGCCAAAGCCCTCAGTCGG - Intergenic
905663039 1:39743059-39743081 GCCACCCCAAAGCCACCTGTGGG - Intronic
910796224 1:91100201-91100223 GCCAAACCAAAGCCCTTTGTGGG - Intergenic
915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG + Intergenic
923957763 1:239042184-239042206 GCCACACCATATCTCACTGGGGG + Intergenic
924193284 1:241578499-241578521 GCCACACTTGAGGCCACTGTGGG + Intronic
1066367719 10:34793062-34793084 GCCACACCAAGTGCCACTGCTGG - Intronic
1068279220 10:54846978-54847000 GCCACATCAAAGTTTACTGTTGG + Intronic
1069662890 10:70135381-70135403 GGCACACCTGAGCCCAGTGTTGG - Intergenic
1070168795 10:73916898-73916920 GCCTCACAAATGCCCACCGTCGG - Exonic
1070715125 10:78714547-78714569 GCATCACCACAGCCCACTGAGGG - Intergenic
1071491219 10:86137823-86137845 GCCAGCCCAAAGCCCACTGCTGG - Intronic
1076313659 10:129525893-129525915 GCCACCCCAAAGCCTCCTGGTGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077163740 11:1125832-1125854 CTCACACCACAGGCCACTGTGGG - Intergenic
1077271316 11:1683422-1683444 GCCACCCCAAATCCCAGTGCCGG + Intergenic
1077555609 11:3224588-3224610 GACACAGCAGAGCCCAGTGTTGG - Intergenic
1078333946 11:10449906-10449928 CCCACTCCAAGGCCCACTCTGGG - Intronic
1081330883 11:41798528-41798550 GCACCACCAAAGCACAGTGTAGG - Intergenic
1081728175 11:45347634-45347656 GCCTCACCAAAGCCCCTTGCAGG - Intergenic
1083193067 11:61066462-61066484 GCCACACCACTGCCCTCTCTGGG - Intergenic
1083196345 11:61090856-61090878 TCCAGTCCAAAGCTCACTGTTGG + Intergenic
1083273735 11:61585441-61585463 GCAACAGCAAAGCCCACTGGTGG + Intergenic
1085023733 11:73224589-73224611 GCCACATCTATGCCCACTGCTGG - Intronic
1087682306 11:101231411-101231433 GCCACACAAGAGCCCACAGTGGG + Intergenic
1088658700 11:112025878-112025900 GCTACAGCAAAGCCAACTATTGG - Intronic
1092741113 12:11630508-11630530 GGCACACCCAAGCCAGCTGTTGG + Intergenic
1093380196 12:18482367-18482389 TCTCCACCAAGGCCCACTGTGGG + Intronic
1099182667 12:79485933-79485955 GCAACACCACAGCTCACTGCTGG + Intergenic
1100212576 12:92412523-92412545 GTCCCACCACTGCCCACTGTGGG + Intergenic
1104142709 12:126004162-126004184 GCCAGACCAAAGTCTGCTGTAGG + Intergenic
1107998276 13:45883061-45883083 CCCACAGCAAAACCCAGTGTGGG - Intergenic
1112376983 13:98851756-98851778 GACACACAAAAGCCAATTGTAGG + Intronic
1113880758 13:113624142-113624164 GCATCACCAAAGCCCAGGGTTGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1115421312 14:33198814-33198836 GCCACGCTGGAGCCCACTGTGGG + Intronic
1118334485 14:64841330-64841352 GCCAGACCCAAGCCCTCTGCAGG + Intronic
1120077264 14:80173000-80173022 GCAACAGCACAGCCCACTCTTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1127636080 15:60871250-60871272 ACCACACCAAAGCACACATTTGG + Intronic
1128150939 15:65363195-65363217 GCCCCACAAAAGCCCACAGGTGG + Intronic
1129609636 15:77042999-77043021 GCCCCTTCAGAGCCCACTGTGGG - Exonic
1130695891 15:86131067-86131089 GCCATAACAAAGCCCAGTATGGG - Intergenic
1133947611 16:10362278-10362300 ACCACAGAAAAGCCCACTGAGGG + Intronic
1139681468 16:68567525-68567547 GCAACACAAAAGCCCAAAGTAGG - Intronic
1143273358 17:5692098-5692120 TTCACACCAAATCCCACTGTAGG + Intergenic
1144271341 17:13619689-13619711 GCCACACGAGGGCACACTGTGGG - Intergenic
1144629686 17:16864684-16864706 GCCACACCACACTCCACTTTCGG - Intergenic
1144651742 17:17011433-17011455 GCCACACCACACTCCACTTTCGG + Intergenic
1144861039 17:18302317-18302339 TCCACCACAAAGCCCAGTGTGGG + Exonic
1148483505 17:47975800-47975822 CCCAGGCCAAAGCCCAGTGTTGG + Intronic
1150868385 17:68878351-68878373 GCGAGACCAAAGCCCTGTGTGGG + Intronic
1151942599 17:77301965-77301987 GCCACTCCAAACCCCTCTGTGGG - Intronic
1155320144 18:24611175-24611197 GCCACACACAGGCCCACCGTTGG + Intergenic
1156670669 18:39465566-39465588 TCCACAGCAGAGCCTACTGTAGG + Intergenic
1157699432 18:49751602-49751624 GCCACCCCAAATCTCCCTGTGGG + Intergenic
1157700163 18:49757293-49757315 GCCAGACCAAGGCCCAGTTTAGG - Intergenic
1163405760 19:17121296-17121318 TCCTCACCACAGCCCACTGAAGG + Intronic
1163816260 19:19466362-19466384 GCCACACCACAGCCCTCAGTGGG - Intronic
1165080630 19:33303933-33303955 GCCAGGCCTAAGGCCACTGTCGG - Intergenic
1165369735 19:35397408-35397430 GCCACACCCCTGCCCACTCTTGG - Intergenic
1168458961 19:56538503-56538525 GCCACACCCAGGCCCAGCGTTGG + Intergenic
1168483346 19:56739885-56739907 GCCCTACAAAAGCCAACTGTTGG - Intergenic
927364714 2:22281036-22281058 TGCACACCAAAGCCTTCTGTAGG + Intergenic
932423379 2:71614105-71614127 GCCACTCCATGGCCCACAGTCGG - Intronic
935315714 2:101831714-101831736 CTCACACCAAAGTCAACTGTGGG - Exonic
936024103 2:109018184-109018206 GCCACATGTAAGCCCATTGTGGG + Intergenic
937226497 2:120373484-120373506 GCATCACCAAAGCCAACTGTGGG - Intergenic
937248326 2:120508487-120508509 CCCACAGCCAAGCCCACTTTGGG + Intergenic
940259639 2:151766424-151766446 AACACACCAAAGGCCACTGTGGG - Intergenic
941618778 2:167753756-167753778 GCTTCACCACAGCCCAGTGTGGG + Intergenic
948478568 2:238236780-238236802 CCCACACCAGTGACCACTGTTGG - Intergenic
1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG + Intronic
1171152619 20:22841154-22841176 TCAACACCAAAAACCACTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172107985 20:32528012-32528034 CCCACCCCAAGACCCACTGTCGG - Intronic
1172793304 20:37520885-37520907 GCCACTCCAAAGCCTACCTTGGG - Intronic
1175721584 20:61290734-61290756 CCCACATCACAGCCCACTGTGGG - Intronic
1179902785 21:44402594-44402616 CCCACCCCAAATCACACTGTGGG + Intronic
1179959385 21:44759543-44759565 GCCCAACCAGAGCCCTCTGTAGG - Intergenic
1179981484 21:44898093-44898115 CCCACCCCAAATCACACTGTGGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180604708 22:17048720-17048742 GCCACACCAGAGCTCAGTGAGGG + Intergenic
1182075688 22:27493962-27493984 GGCAAACCACAGCCCACCGTGGG + Intergenic
1183299985 22:37054153-37054175 ACAACACCAGAGTCCACTGTAGG + Intronic
956459264 3:69454713-69454735 GCTGCACCAGAGCCCACTGCGGG - Intronic
956890221 3:73606114-73606136 ACCACACCAAAGCCTACTGTTGG - Intronic
959560083 3:107769356-107769378 GCCTCACAACAGCCCAATGTAGG + Intronic
963584873 3:147174413-147174435 GCCACACCAAATACCATTCTTGG + Intergenic
964176899 3:153834715-153834737 GCAACACCTAAGCACACAGTTGG - Intergenic
965784299 3:172319755-172319777 GCAACATCAAAGACCAATGTTGG - Intronic
968196367 3:196710728-196710750 GCCACACCAAAGGCCAAGGTGGG + Intronic
968594214 4:1474025-1474047 GCCTCAGCAAAGGCCACTTTGGG - Intergenic
968892325 4:3376016-3376038 GTCACACCATAACCCTCTGTTGG - Intronic
973135291 4:46699138-46699160 GCCACACAGGAGCCCACCGTGGG - Intergenic
975842391 4:78488753-78488775 GCTCCACCAAAGCCCAAGGTAGG - Intronic
976112778 4:81693850-81693872 GCCCCACCAAAGCCCCATTTAGG - Intronic
977641214 4:99359964-99359986 GCCATGCCCAAGCCCACTGCGGG - Intergenic
978195687 4:105969201-105969223 GACACATCAAAGCCATCTGTGGG + Exonic
978683787 4:111415137-111415159 GCCATCCCAAAGCCATCTGTAGG + Intergenic
981082492 4:140649172-140649194 GCAACAACAAAGCTCAATGTAGG + Intronic
982687699 4:158511192-158511214 GCAACTTCAAAGGCCACTGTAGG + Intronic
985324741 4:188754778-188754800 GCCACACGGGAGCCCATTGTGGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
986124826 5:4875220-4875242 GCCACACCACAGACAAGTGTGGG + Intergenic
989956889 5:50369724-50369746 GCCACACAGAAGCCCACAGAGGG - Intergenic
992563475 5:77974685-77974707 TCCCAACCAAATCCCACTGTAGG - Intergenic
994922495 5:106066914-106066936 GGCACACCAAATCACAATGTAGG - Intergenic
994993976 5:107036243-107036265 GACACACCAAAGCCTTATGTTGG + Intergenic
996341517 5:122444008-122444030 TCCTCACCATAGCCCATTGTGGG + Intronic
997613257 5:135229778-135229800 GCAACACCAGAGCCCTCTGGAGG - Intronic
1001862113 5:175066291-175066313 GTCACACCAAAGACCACAGAAGG - Intergenic
1004656331 6:17665761-17665783 CCCAGACCACAGCTCACTGTAGG + Intronic
1008645823 6:53513557-53513579 GCCACACAAAAGCCTGCAGTTGG - Intronic
1012822591 6:104105611-104105633 CCCACACCAAGGCCGACTGGGGG + Intergenic
1013957282 6:115855485-115855507 GCCACGCGGAAGCCCACGGTGGG - Intergenic
1014873482 6:126626594-126626616 GGCTTACCAAAGCCAACTGTGGG - Intergenic
1015381980 6:132580132-132580154 AGCACACCAAACTCCACTGTGGG - Intergenic
1016991613 6:149933616-149933638 TCCACAGCACAGCTCACTGTTGG - Intergenic
1020820000 7:12955371-12955393 GCCAAAACACAGCCTACTGTTGG - Intergenic
1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG + Intronic
1028012149 7:85659558-85659580 GCCTCATCACATCCCACTGTGGG + Intergenic
1028089905 7:86685935-86685957 ACTACACCAAAGACCACTGTGGG + Intronic
1028887507 7:95950439-95950461 CCCACACTAAAGCCCATTTTTGG - Intronic
1031799398 7:126223583-126223605 GCCACAGCAAGCCCCACTGAAGG - Intergenic
1031957154 7:127954250-127954272 TCCATACAAAACCCCACTGTTGG - Intronic
1032150238 7:129422788-129422810 GCCATAGCAAGCCCCACTGTGGG - Intronic
1032184375 7:129711224-129711246 GCCACATCCATGCCCAGTGTTGG - Intronic
1033946069 7:146719232-146719254 GCCTCAGCAAAGCTGACTGTTGG - Intronic
1034677163 7:152900228-152900250 GCCACAGCAAAGTCCAGTGCAGG - Intergenic
1036544221 8:9750715-9750737 GCCACCCCCAAACCCACTGAGGG + Intronic
1037589434 8:20300828-20300850 ACCACACCCAGCCCCACTGTGGG - Intronic
1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG + Intronic
1042035197 8:64525528-64525550 GACAAACCAAAGCCCTCTCTGGG - Intergenic
1042832978 8:73051588-73051610 GACCCTCCAAAGCCCTCTGTTGG + Intergenic
1044749391 8:95401636-95401658 GCCAAACAAAAGCCATCTGTGGG + Intergenic
1047961076 8:130012301-130012323 GCCACACAAAAGTCCACAATTGG + Intronic
1049108389 8:140627845-140627867 ACCACCACAAAGTCCACTGTGGG + Intronic
1049605193 8:143526071-143526093 GCTACACCAAAACCCACGCTAGG + Intronic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1058309536 9:103483974-103483996 GCCACACAGAAGCCCACGGGTGG - Intergenic
1061193516 9:129095349-129095371 GCCACAGCCAAGCCCACCCTGGG - Exonic
1061292038 9:129655904-129655926 GTCACACGCAAGCCCACAGTGGG + Intergenic
1061499340 9:130993253-130993275 GGTACAACAAAGCCCACTGTAGG + Intergenic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185601099 X:1339838-1339860 GCCACCCCAGAGCACAGTGTAGG + Intronic
1186031590 X:5374917-5374939 GCCACACAAATGTCCACTGGTGG - Intergenic
1186295615 X:8145047-8145069 GCCACACAGGAGCCCACTGAGGG + Intergenic
1194466205 X:94237671-94237693 GCCACACCAAGGCCCACCCAAGG - Intergenic
1198060952 X:133044664-133044686 GCCACACAGGAGCCCACGGTGGG - Intronic
1198310939 X:135425356-135425378 GCCACACCAGAAGCCACTGGGGG - Intergenic
1200043738 X:153388573-153388595 TCCACACCAAATCCCTCTGGAGG + Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic