ID: 1170572753

View in Genome Browser
Species Human (GRCh38)
Location 20:17641702-17641724
Sequence GATCCCGGGCTCCGAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 77}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170572753_1170572767 11 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572767 20:17641736-17641758 GGGCGGGGGTCCTCTGAGGACGG 0: 1
1: 0
2: 2
3: 34
4: 286
1170572753_1170572762 -4 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572762 20:17641721-17641743 GATCCACCGTGGATGGGGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 88
1170572753_1170572758 -9 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572758 20:17641716-17641738 CCCGGGATCCACCGTGGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 97
1170572753_1170572766 7 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572766 20:17641732-17641754 GATGGGGCGGGGGTCCTCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 267
1170572753_1170572760 -6 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572760 20:17641719-17641741 GGGATCCACCGTGGATGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 171
1170572753_1170572763 -3 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572763 20:17641722-17641744 ATCCACCGTGGATGGGGCGGGGG 0: 1
1: 0
2: 1
3: 37
4: 124
1170572753_1170572756 -10 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572756 20:17641715-17641737 GCCCGGGATCCACCGTGGATGGG 0: 1
1: 0
2: 0
3: 0
4: 43
1170572753_1170572769 17 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572769 20:17641742-17641764 GGGTCCTCTGAGGACGGGAGAGG 0: 1
1: 1
2: 2
3: 29
4: 280
1170572753_1170572761 -5 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572761 20:17641720-17641742 GGATCCACCGTGGATGGGGCGGG 0: 1
1: 0
2: 3
3: 12
4: 152
1170572753_1170572768 12 Left 1170572753 20:17641702-17641724 CCAGCATCTCGGAGCCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1170572768 20:17641737-17641759 GGCGGGGGTCCTCTGAGGACGGG 0: 1
1: 0
2: 0
3: 23
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170572753 Original CRISPR GATCCCGGGCTCCGAGATGC TGG (reversed) Intronic