ID: 1170573845

View in Genome Browser
Species Human (GRCh38)
Location 20:17648023-17648045
Sequence GAGGCTGATGACTGCTTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170573845_1170573848 3 Left 1170573845 20:17648023-17648045 CCACGCAAGCAGTCATCAGCCTC No data
Right 1170573848 20:17648049-17648071 AGACCAAGATTCAGAGGCTGAGG No data
1170573845_1170573847 -3 Left 1170573845 20:17648023-17648045 CCACGCAAGCAGTCATCAGCCTC No data
Right 1170573847 20:17648043-17648065 CTCTGCAGACCAAGATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170573845 Original CRISPR GAGGCTGATGACTGCTTGCG TGG (reversed) Intronic