ID: 1170573845 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:17648023-17648045 |
| Sequence | GAGGCTGATGACTGCTTGCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170573845_1170573848 | 3 | Left | 1170573845 | 20:17648023-17648045 | CCACGCAAGCAGTCATCAGCCTC | No data | ||
| Right | 1170573848 | 20:17648049-17648071 | AGACCAAGATTCAGAGGCTGAGG | No data | ||||
| 1170573845_1170573847 | -3 | Left | 1170573845 | 20:17648023-17648045 | CCACGCAAGCAGTCATCAGCCTC | No data | ||
| Right | 1170573847 | 20:17648043-17648065 | CTCTGCAGACCAAGATTCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170573845 | Original CRISPR | GAGGCTGATGACTGCTTGCG TGG (reversed) | Intronic | ||