ID: 1170576587

View in Genome Browser
Species Human (GRCh38)
Location 20:17667247-17667269
Sequence TTTTCTTAAAGGGGGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170576580_1170576587 10 Left 1170576580 20:17667214-17667236 CCATAAAACCATCAGGATTAGTG 0: 1
1: 0
2: 1
3: 11
4: 184
Right 1170576587 20:17667247-17667269 TTTTCTTAAAGGGGGAAGGCTGG 0: 1
1: 1
2: 1
3: 35
4: 307
1170576579_1170576587 11 Left 1170576579 20:17667213-17667235 CCCATAAAACCATCAGGATTAGT 0: 1
1: 0
2: 1
3: 12
4: 243
Right 1170576587 20:17667247-17667269 TTTTCTTAAAGGGGGAAGGCTGG 0: 1
1: 1
2: 1
3: 35
4: 307
1170576581_1170576587 2 Left 1170576581 20:17667222-17667244 CCATCAGGATTAGTGTTCTGAGA 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1170576587 20:17667247-17667269 TTTTCTTAAAGGGGGAAGGCTGG 0: 1
1: 1
2: 1
3: 35
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170576587 Original CRISPR TTTTCTTAAAGGGGGAAGGC TGG Intronic
901015324 1:6226086-6226108 TGTTCTTAAAGGTGGAAGAAAGG - Intronic
902295335 1:15463206-15463228 CTTGTTGAAAGGGGGAAGGCAGG - Intronic
902298178 1:15482738-15482760 TTTGTTGAAAGGGGGAAGGCAGG - Intronic
903729399 1:25480293-25480315 GTTTCTTAAACTGGGAATGCTGG + Intronic
904506308 1:30957761-30957783 TTCTTTAAAAGTGGGAAGGCAGG - Intronic
904681123 1:32230033-32230055 TTTTATTATATGGGGAAGACTGG - Intronic
905023528 1:34834521-34834543 TTTATTTAAAGAGGGTAGGCTGG - Intronic
908419918 1:63949753-63949775 GTTTCTCAAAGGGGGTAGCCCGG + Intronic
909959340 1:81819855-81819877 CTTTCTGAAAAGGGGCAGGCTGG - Intronic
910129409 1:83885828-83885850 TTTTTTTAAAAGGTGAAGGGAGG + Intronic
910177648 1:84448039-84448061 TTTTCTTTAAGGTGTAAGGAAGG - Intergenic
911116761 1:94253688-94253710 TTTTCTCTAAGGGAGAAGGCTGG + Intronic
911545962 1:99217528-99217550 TTTTTTTAATGGGGGAAAACTGG - Intergenic
913970698 1:143413551-143413573 TTTTCATTAAGGGGGAAAGAAGG - Intergenic
914065075 1:144239162-144239184 TTTTCATTAAGGGGGAAAGAAGG - Intergenic
914114076 1:144727192-144727214 TTTTCATTAAGGGGGAAAGAAGG + Intergenic
917322452 1:173797435-173797457 TTTACTTATAGGGAGAAGGAAGG - Intergenic
920747873 1:208645956-208645978 TCCTCATAAAGGGGGAAGACTGG + Intergenic
920875032 1:209827015-209827037 TGTTGTTAAATGGGGAATGCTGG + Intergenic
922446295 1:225700653-225700675 GTTTCCTAAAAGGGGAAGGCCGG - Intergenic
923382498 1:233435613-233435635 TTTTGTTAATTGGGGAAGTCAGG + Intergenic
923859762 1:237881820-237881842 TTTTTTTAAAGGGGGTGGGTGGG - Intronic
1062974553 10:1673881-1673903 TTTTATGAAAGGATGAAGGCAGG - Intronic
1063181961 10:3610629-3610651 TTTTATAAAAGGAGGGAGGCAGG - Intergenic
1063306817 10:4910072-4910094 TTTTCTAAAAGGGGGAAAAAAGG - Intergenic
1064830119 10:19454286-19454308 ATTTCTATAAGGGGGAAGGCAGG + Intronic
1066249301 10:33617438-33617460 TGTTCTTGAAGAGGGAAGGTGGG - Intergenic
1066617912 10:37314590-37314612 TTTTATTGAAGGTGGAGGGCGGG + Intronic
1067526285 10:47040599-47040621 TGTTTTAAAAGGGGGAAGGGTGG + Intergenic
1069775543 10:70925165-70925187 TTTTCTTCCAGAAGGAAGGCAGG + Intergenic
1069809616 10:71148738-71148760 ATTCCTTAAAGGGGGAGGGCAGG - Intergenic
1070336607 10:75461377-75461399 TTTTTTCAGAGGTGGAAGGCAGG + Intronic
1071177416 10:82942527-82942549 TTTTCTTAAAGGGAGAAGTGAGG + Intronic
1074925840 10:118069928-118069950 TTTTCTGAGAGGTGGAAGGCAGG + Intergenic
1075139587 10:119819236-119819258 TTTTTTTTAAAGGGGAAGGGTGG + Intronic
1075139588 10:119819237-119819259 TTTTTTTAAAGGGGAAGGGTGGG + Intronic
1077643793 11:3905378-3905400 TTTTTTTAAAGGTGGAGGGGTGG + Intronic
1078370168 11:10737648-10737670 TTTGCTGAGATGGGGAAGGCAGG - Intergenic
1078933903 11:15935805-15935827 TCTTCTTAAATGTGGAAGGGGGG - Intergenic
1078952281 11:16147548-16147570 TTTCCTTAAAGGGAAAAGGATGG + Intronic
1080869305 11:36223414-36223436 ATTTCTTAAAGGAGGAAAGTGGG - Intronic
1081470002 11:43360759-43360781 ATGTATTAATGGGGGAAGGCAGG + Intronic
1082915035 11:58424276-58424298 GTTTCATAAAGGAGGATGGCAGG + Intergenic
1084102581 11:66959298-66959320 TTTCCTTAAAGGGGGAATGAGGG + Intergenic
1084223990 11:67703619-67703641 TTGTCTTAAAGGAGAAAGGGAGG - Intergenic
1085120408 11:73964078-73964100 TCATCTTAATGGTGGAAGGCAGG + Intronic
1085824340 11:79827731-79827753 TTTACTAAGATGGGGAAGGCTGG + Intergenic
1086352240 11:85953938-85953960 TTTTCTTTTTGGGGGAAGGCTGG - Intergenic
1089081748 11:115781939-115781961 TTCTTACAAAGGGGGAAGGCTGG + Intergenic
1089432179 11:118434313-118434335 TTTTCTCAAGGGTAGAAGGCGGG + Exonic
1090563443 11:127959402-127959424 TTTTATTAAAGGGAGCAGGCTGG - Intergenic
1090761283 11:129838867-129838889 TTATTTTAGAGGGGGAAAGCAGG - Intronic
1090886721 11:130883663-130883685 TTTGCTGACAGGGGGAAGGGTGG - Intronic
1091094067 11:132802019-132802041 TTTACTTAGATGGTGAAGGCTGG - Intronic
1091519329 12:1220273-1220295 TATTTTTAAAAGGGGGAGGCGGG - Intronic
1091530030 12:1345518-1345540 TTTTCTTAAACTTGGAAGGATGG - Intronic
1092712342 12:11352529-11352551 TTTTCTGAAGGAGGGGAGGCAGG + Intronic
1092716078 12:11392249-11392271 TTTTCTGAAGGAGGGGAGGCAGG + Intronic
1093634051 12:21443020-21443042 TTTTTTTAATGGGGGAATGAAGG + Intronic
1094678748 12:32648622-32648644 TTTTACTAAAGTGGGAAGGAAGG - Intergenic
1094717520 12:33027888-33027910 TTTTCTGCAAGTGGGAAGGAGGG + Intergenic
1095769856 12:45941642-45941664 GTTACTGAAATGGGGAAGGCTGG - Intronic
1096107010 12:49002075-49002097 TTTTCTTAGTTGGGGAAGGTTGG - Intergenic
1096221136 12:49828611-49828633 GTTTCTATAAGGGGGAAGGGAGG - Intronic
1096309297 12:50505656-50505678 CTTTTTGAAAGGGGGAAGGGGGG - Intronic
1096310315 12:50514952-50514974 TTTTTTTAAAGCTGGAAGGCTGG - Intronic
1096459718 12:51815290-51815312 TTTTCGTAAAGGGGAACGGTTGG - Intergenic
1096726895 12:53571504-53571526 TTTTTTTAAAAGGGAAAGCCAGG + Intronic
1096759555 12:53829177-53829199 TTTTCTTAAGGGGGGAGTGTAGG + Intergenic
1097931091 12:65187587-65187609 TTTTTTTAAAGGGGGGAAGTGGG - Intronic
1098038709 12:66333379-66333401 TTTTATTCAAAGAGGAAGGCAGG + Intronic
1098520543 12:71431128-71431150 TTTATTTAAAAAGGGAAGGCAGG + Intronic
1098899656 12:76099813-76099835 TTTGTTTAAAGGGGGAAGCTGGG + Intergenic
1099022671 12:77425503-77425525 TTTTCTTTAAGGTGTAAGGAAGG + Intergenic
1100983698 12:100185305-100185327 GCTTCCTAAAGGGGGAATGCAGG + Intergenic
1101001998 12:100366068-100366090 TTTTTTTTCAGGGGGTAGGCTGG + Intronic
1102999133 12:117371896-117371918 TATTCTTAAAGGGGAAAGTCTGG + Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1106667478 13:31867397-31867419 TTTTCTTGGAGGGGGAAGCATGG - Intergenic
1107879879 13:44823639-44823661 TTTTATTTAAAGGGAAAGGCTGG - Intergenic
1108022770 13:46145611-46145633 ATTTCTAAAAGAGGGCAGGCCGG + Intronic
1110516458 13:76418519-76418541 TTTTCTTCGAGTGGGAAGCCTGG + Intergenic
1110857192 13:80309956-80309978 TTTTTTTAAAGAAGGAAGGAAGG + Intergenic
1110987273 13:81986312-81986334 AATATTTAAAGGGGGAAGGCAGG + Intergenic
1114306940 14:21431714-21431736 TTTTCTTAATAGGGGAGGGGAGG - Intronic
1117686881 14:58262500-58262522 TTCTCTTTAAAAGGGAAGGCAGG - Intronic
1118739767 14:68731095-68731117 TTTTCCCAAAGGGGGAGGGGTGG + Intergenic
1118743251 14:68756398-68756420 TTTGTTTAAAAGGGGGAGGCTGG - Intergenic
1119888311 14:78163040-78163062 GTTTCTTAAAGGAAGAAGGTAGG - Intergenic
1120164825 14:81186460-81186482 TTTTCTTAAAGGCAGAAAGTAGG + Intronic
1120198334 14:81511686-81511708 GTTGCTTAAATGGGGATGGCAGG - Intronic
1120578675 14:86217827-86217849 TTTTCTTAAGGGCGGGAGGCCGG - Intergenic
1120702708 14:87715382-87715404 TTTTCTTTTAGAGGGAAGGAAGG - Intergenic
1121482513 14:94290152-94290174 GTCCCTTAAAGAGGGAAGGCAGG + Exonic
1124694741 15:31854576-31854598 CTTTCTTAAAAGTGGAAGGAGGG - Intronic
1125061127 15:35425905-35425927 TTTTCTTCACTGGGTAAGGCAGG - Intronic
1126437961 15:48655242-48655264 TTTTCCTAAAGAGGAAAGGGAGG - Intergenic
1126506442 15:49409284-49409306 TTTTCATAAAGGGGGTGGGGAGG - Intronic
1126606140 15:50478599-50478621 TTTTCTTAAAGGGTGAATTTAGG + Intronic
1126675352 15:51155783-51155805 ATTTCTTTAAAGTGGAAGGCAGG - Intergenic
1126867765 15:52954944-52954966 TTTTCTGGAAGGGGAAAGGAGGG - Intergenic
1127546490 15:59998152-59998174 TTTTTTTAAAGTGGGGAGGGAGG - Intergenic
1127815464 15:62604908-62604930 GTTTCTTAATGGGGGAAAGGAGG - Intronic
1128284552 15:66425586-66425608 TTTTTTTAGTGGGGGATGGCGGG + Intronic
1128694570 15:69751108-69751130 TCTTCTTAAACTGGGAAGGCAGG + Intergenic
1128749233 15:70136933-70136955 TTCTTTTACAGGGGGAAGACAGG + Intergenic
1134104330 16:11475155-11475177 TTTGTTTAAAGGGGAAAAGCGGG - Intronic
1134781882 16:16905717-16905739 TTTTCTTTCAGGATGAAGGCAGG + Intergenic
1137491145 16:48933718-48933740 TTTTCAGACAGGGGGATGGCTGG + Intergenic
1139774338 16:69305908-69305930 TTAGCTTAAAGGGTGGAGGCGGG - Exonic
1140223837 16:73063608-73063630 TTTTCGTAAACGGGGAGGGGGGG - Intergenic
1143367628 17:6418615-6418637 TTTTCTTACAGGGGGTTGGGGGG - Intronic
1143435081 17:6918328-6918350 TTTCCTTATAAGGGGATGGCAGG + Intronic
1143790145 17:9288169-9288191 TTTTTTTTCAGGGGGAAGGTTGG - Intronic
1143904786 17:10199359-10199381 TTTACTTGCAGAGGGAAGGCCGG + Intergenic
1144178743 17:12732627-12732649 TCCTCTTAAAATGGGAAGGCTGG + Intronic
1146464802 17:33077974-33077996 TTTTTTTAAAGGGGGAAAAAGGG - Intronic
1147224702 17:38967580-38967602 TATTCATAAAGCGGGGAGGCGGG - Intergenic
1147351353 17:39848186-39848208 TTTTTTTAAAGGGGGAGGGTAGG - Intronic
1149461242 17:56831905-56831927 TTTTGATATAGGGGGAAGGATGG - Intronic
1150361231 17:64536164-64536186 TTATTTTAAAAGGGTAAGGCTGG + Intronic
1150976312 17:70091010-70091032 TTTTTGTAAAGTGGGAAGGCTGG - Intronic
1150994537 17:70301076-70301098 TTTTCTTAACAGGGGAATGCTGG + Intergenic
1151296896 17:73192783-73192805 TTTTCTTAAACGGAGCCGGCTGG - Intronic
1155709190 18:28854832-28854854 TTTTTTTAAAGGGGGAGGGTGGG - Intergenic
1155850410 18:30767375-30767397 TTTTCTGATAGGGAAAAGGCAGG - Intergenic
1156524548 18:37754416-37754438 TCTGCTTAAAGGCAGAAGGCTGG + Intergenic
1157359076 18:46962294-46962316 TTTTCTTTTAGGGAAAAGGCCGG - Intronic
1157360070 18:46968221-46968243 TTTTCTTTTAGGGAAAAGGCCGG - Intronic
1157610838 18:48954038-48954060 TGTTCTTAAAAGGAAAAGGCAGG + Intergenic
1158403490 18:57141273-57141295 TTTTCCGGAAGGGGGAAGGCAGG - Intergenic
1158844166 18:61423685-61423707 TTTTTTTATGGGGTGAAGGCTGG - Intronic
1159578741 18:70210675-70210697 TATTCTGAAAGAAGGAAGGCTGG - Intergenic
1162871193 19:13588025-13588047 TTTTCTTAAGGGAGGCAGGCTGG - Intronic
1166197917 19:41219055-41219077 CTTTCTTAAAGGGGCCAGGGAGG - Intergenic
1167392524 19:49205354-49205376 TTTTATTAAAAGGGGAAATCTGG - Intronic
925020754 2:565813-565835 TTTTCATGACGGGGGATGGCAGG - Intergenic
925235436 2:2273227-2273249 TTTTCTCAATGGCTGAAGGCAGG - Intronic
925422438 2:3723842-3723864 TTTTCTGAGATGGGGAAGCCTGG + Intronic
925574649 2:5348698-5348720 TTTTCTTACAGCAGGTAGGCAGG + Intergenic
925808868 2:7678765-7678787 TATGTTTAAAGGAGGAAGGCTGG + Intergenic
926942319 2:18151582-18151604 TCTTATTAAAGAGGGAAGGTTGG + Intronic
927277338 2:21273097-21273119 TTTTCCTAAAGGGGGCAGACAGG + Intergenic
929227379 2:39524812-39524834 ATTTTTTAAAGGGGGTAGGAAGG - Intergenic
929686539 2:44039974-44039996 TTTTGTTAAAGAGGCAAGGCTGG + Intergenic
931095188 2:58931914-58931936 TTTTTTTAAACGAGAAAGGCTGG - Intergenic
933669258 2:84991238-84991260 TTTACTGACATGGGGAAGGCAGG + Intronic
933833420 2:86228049-86228071 TTTGCTTAAAGGGTCAGGGCAGG - Intronic
934125172 2:88881428-88881450 TTTTCTGAGATGGGGAAGGCAGG - Intergenic
934175394 2:89574477-89574499 TTTTCATTAAGGGGGAAAGAAGG - Intergenic
934285710 2:91648840-91648862 TTTTCATTAAGGGGGAAAGAAGG - Intergenic
935791374 2:106593329-106593351 TTTTTTTAAAGTGGTAGGGCAGG + Intergenic
938753479 2:134357836-134357858 GTTTCTTCAAGAGAGAAGGCTGG - Intronic
938950176 2:136248065-136248087 TTTTCCTAAAGTATGAAGGCTGG + Intergenic
941295511 2:163734542-163734564 TTTTTTTGAAGGAGGGAGGCTGG - Intronic
941348712 2:164404252-164404274 TGTTCAAAAAGGGGGAAAGCAGG - Intergenic
942158622 2:173158327-173158349 TTTTTTTAAAGGGAGAAAGGGGG + Intronic
942804299 2:179911532-179911554 TTATATAAAAGGGGGTAGGCTGG + Intergenic
943210304 2:184955821-184955843 TTTTCTCACAGTGTGAAGGCCGG - Intergenic
943961539 2:194270804-194270826 TTTCCTTGAAGGGGGATGGGAGG + Intergenic
944230901 2:197391356-197391378 TGTTCTTAAAGGTAGAGGGCAGG + Exonic
944606635 2:201357436-201357458 TTTTCTTCAAGAGAGAAGGTTGG + Intergenic
944987026 2:205188767-205188789 TTTTTTGAAAGGCAGAAGGCAGG - Intronic
946376898 2:219315922-219315944 TTTTCTTAAAGAGGGAACAAAGG - Intergenic
947260136 2:228211954-228211976 TTTTCTAAGAGGTGGAAGACTGG - Intergenic
1169688542 20:8304539-8304561 CTTTAATAAAAGGGGAAGGCAGG + Intronic
1169924857 20:10772278-10772300 TTTTCTCTTATGGGGAAGGCAGG + Intergenic
1170120064 20:12901772-12901794 TTTTTTTAAAAGGTGAAGGCAGG - Intergenic
1170576587 20:17667247-17667269 TTTTCTTAAAGGGGGAAGGCTGG + Intronic
1173216285 20:41087824-41087846 TTTGCTTGAAGGGGGAAAGGTGG - Intronic
1173366796 20:42393168-42393190 CTTTCTTCAGGGGAGAAGGCTGG + Intronic
1173790864 20:45827067-45827089 TTTTCTTGAAAGGGGAGGGCTGG - Intronic
1174120605 20:48262387-48262409 GTTTCCTAAAGGGGAAAGGCAGG + Intergenic
1174381532 20:50158884-50158906 TTTTTTTAAAAAGGGAAGTCTGG - Intergenic
1176720106 21:10385755-10385777 TTTTCTTTAAGGGTGCAGGTTGG - Intergenic
1177384583 21:20392210-20392232 TTTTGTTTAAGGGGTAAGGAAGG + Intergenic
1177765555 21:25453151-25453173 TTTCCTTGAAGAGGGAAGGTAGG - Intergenic
1178304458 21:31479852-31479874 TTTTCTAAAAGAGGGAAAACAGG - Intronic
1179167003 21:38943219-38943241 GTTTTTTAATGGGGGAAGCCAGG - Intergenic
1179224294 21:39439920-39439942 CTGTCTGAAAGAGGGAAGGCTGG + Intronic
1180301311 22:11038532-11038554 TTTTCTTTAAGGGTGCAGGTTGG - Intergenic
1180301479 22:11039911-11039933 TTTTCTTTAAGGGTGAAGGTTGG - Intergenic
1182006260 22:26962137-26962159 ATTTCTGAGAGGAGGAAGGCAGG + Intergenic
1182246124 22:28959151-28959173 TTTTCTTGGAGGAAGAAGGCAGG + Intronic
1183020843 22:35024594-35024616 TTTTTGTCAAGGGAGAAGGCAGG - Intergenic
949559119 3:5186847-5186869 TTTTTTTAAAAGGGGGGGGCGGG - Intergenic
950293145 3:11804018-11804040 TTTTCTTACATGGTGAAGTCTGG - Intronic
951439245 3:22704340-22704362 ATTTCTGAAAAGGGGAAGGAAGG + Intergenic
951463860 3:22979861-22979883 TTTAAGTAAAGGGGTAAGGCTGG + Intergenic
951640747 3:24831942-24831964 TTTTCTGAAAGTGAGAAGGAAGG + Intergenic
951823731 3:26843656-26843678 TTATCTTAAAAGTAGAAGGCCGG - Intergenic
954905286 3:54056999-54057021 TATTTTTAAAGAGGTAAGGCAGG - Intergenic
955279047 3:57576520-57576542 TTTTTTTGAAGAGGGAAAGCTGG + Intronic
956096480 3:65721588-65721610 GATTCTTAAAGCAGGAAGGCAGG - Intronic
956742793 3:72288222-72288244 TGTTCTTAAAGGGGGAAATTGGG - Intergenic
956982225 3:74652122-74652144 TTGGCTTAAAGGGAGAAGACTGG + Intergenic
957166688 3:76682775-76682797 TTTGCTGAAATGTGGAAGGCTGG + Intronic
957589949 3:82183592-82183614 TTTTCTTACAGGGATAAGGATGG - Intergenic
958096587 3:88953478-88953500 TTTTCTTAGACGGGGAAAGATGG - Intergenic
960029482 3:113042863-113042885 TTTTCTGAAAGGAGAAAGGAAGG - Intergenic
960615117 3:119589367-119589389 TTTTCTCAAAAGGAGAAGGAAGG - Exonic
961589334 3:127964305-127964327 TGTGCTTAAAGAGTGAAGGCAGG - Intronic
961809407 3:129513331-129513353 TTTCCTTACAGAGGGAAGGTGGG - Intronic
962070487 3:132028932-132028954 TTTTTTTAAAGGGTGAAGTTTGG + Intronic
962682699 3:137816076-137816098 TTCTCCAAAATGGGGAAGGCAGG + Intergenic
962795505 3:138846427-138846449 TTTTCTTAAAGGAAAAAGGCTGG - Intergenic
963886009 3:150583304-150583326 TATAATAAAAGGGGGAAGGCTGG - Intronic
964819121 3:160751503-160751525 ATTTTTTAAAAGGGCAAGGCAGG + Intergenic
964881363 3:161426723-161426745 TTTTTTTTAAGGCAGAAGGCTGG - Intergenic
966946802 3:184782612-184782634 TTTTTTTGAGGGGGGGAGGCGGG - Intergenic
967057871 3:185845611-185845633 ATTTCTGAAAGGAGGAAGGAGGG + Intergenic
969236127 4:5866174-5866196 TTTTCTTTAAGTGCCAAGGCTGG + Intronic
969344321 4:6561849-6561871 TTTTCAGAAAAGGGGTAGGCAGG - Intronic
971138768 4:23900626-23900648 TTTTCTTAGGTGAGGAAGGCAGG - Intronic
972576653 4:40358080-40358102 TTTTTTTAAAGAGGGAAGTTCGG - Intergenic
973085122 4:46049044-46049066 TTTTTTTAAAGGGAAAATGCTGG + Intronic
973288063 4:48441588-48441610 TTTTTTTCAAGGGTGAAGGAGGG - Intergenic
973609311 4:52619332-52619354 TTTTCTGAAAGCATGAAGGCTGG + Intronic
973761617 4:54122191-54122213 TTTTCATAATGTGGGAAGGCAGG - Intronic
976462356 4:85327096-85327118 TTTTCTTTAAGGTGTAAGGAAGG - Intergenic
976519150 4:86006439-86006461 TTTTCTTAAATAGGGAATGAGGG + Intergenic
977572517 4:98644201-98644223 TTGTCCTAAGGGGGAAAGGCCGG + Intronic
977807980 4:101325063-101325085 TTTTTTTAAAGGGGGAGGAAAGG + Intronic
978017373 4:103762072-103762094 TTTTCTAAAAGGGCCAAGGTAGG - Intergenic
981008634 4:139901757-139901779 TTTTCTGGAAGGAGGGAGGCGGG + Intronic
981226608 4:142302474-142302496 TGCTCTTAAATGGGAAAGGCAGG - Intronic
981527210 4:145718943-145718965 TTATTTTAAAGGTGGTAGGCAGG - Intronic
982683085 4:158456213-158456235 TCTACTTGAAGGGGGAAGGTGGG + Intronic
983086301 4:163448981-163449003 GTCTTTAAAAGGGGGAAGGCTGG + Intergenic
983185835 4:164699678-164699700 TTCTCTTCATGGGGGTAGGCGGG - Intergenic
984197150 4:176671933-176671955 TTCTTTTAAAAGGGGAAGGAGGG + Intergenic
984546507 4:181110675-181110697 TTTTCCTAGAGGGAGAAGGGAGG + Intergenic
984644912 4:182209267-182209289 TTTTTTTAAAGAGGGACAGCTGG - Intronic
984671573 4:182495114-182495136 TTGTCTTAAAGGAGGAAGGCGGG - Intronic
986068075 5:4255478-4255500 TTATTTTAAAGGGTGAAGGTGGG + Intergenic
990190630 5:53256179-53256201 TGTTCTGAAAGGGGCAAGGATGG - Intergenic
991676885 5:69096957-69096979 TTTTTTTGGAGGGGAAAGGCGGG - Intronic
992195490 5:74335065-74335087 TTTCCTTGAAAAGGGAAGGCAGG + Intergenic
992507446 5:77401177-77401199 TTTTCAGAAAGGGGGAAGGAAGG - Intronic
992649032 5:78839077-78839099 CTTTTGTAAATGGGGAAGGCTGG + Intronic
993914139 5:93721147-93721169 GGTTTGTAAAGGGGGAAGGCAGG + Intronic
994157028 5:96515131-96515153 TTTTCTTAAACGCAGAAGGATGG + Intergenic
996937753 5:128967419-128967441 TCTTCTTCAATGGGGAAGGAAGG + Intronic
997592542 5:135084750-135084772 TTTTCTTGAAGTGGGATTGCTGG + Intronic
998858822 5:146423147-146423169 TTTTCTCAAAGGAAGAATGCTGG - Intergenic
1000184346 5:158844199-158844221 TTTTTTTTGAGGGGGAAGGAAGG + Intronic
1000245060 5:159442221-159442243 TTTTCTTAAAGATGGAAGATGGG - Intergenic
1000458549 5:161483808-161483830 TTTTCATTAAAGGGGAAGGTTGG - Intronic
1000629071 5:163571595-163571617 ATTTCTGAAAGGAGAAAGGCTGG - Intergenic
1001027807 5:168238825-168238847 TTTTATTAACTGGGGAAGCCAGG + Intronic
1001035322 5:168292568-168292590 TCTTCCTAAAGGGGGCGGGCGGG - Intronic
1001971817 5:175962094-175962116 TTTTTTTAATGGGGGAAGAATGG + Intronic
1002245626 5:177881687-177881709 TTTTTTTAATGGGGGAAGAATGG - Intergenic
1003911373 6:10747282-10747304 TTTTCTTGCAGGTGGAAGGCAGG + Intergenic
1004748174 6:18533807-18533829 TTTTCATCATGGGTGAAGGCAGG - Intergenic
1005785110 6:29237001-29237023 TTTTCTTGAGGGTGGAAGGTGGG - Intergenic
1005869344 6:29962693-29962715 TTCTCTTTAAGGGGGAACACGGG - Intergenic
1005957761 6:30676585-30676607 TTTTCCCCAAGAGGGAAGGCTGG - Exonic
1007914462 6:45548031-45548053 TTTGCATAAAAGGAGAAGGCAGG - Exonic
1007956513 6:45922623-45922645 TTTTCTTAAAGTATGAAGGGAGG + Intronic
1008450639 6:51646649-51646671 TTTACTGAAATGGGGAAGACTGG - Intronic
1009042450 6:58195420-58195442 TTTTCTTAAAAGAGGCAGACTGG - Intergenic
1009218295 6:60949642-60949664 TTTTCTTAAAAGAGGCAGACTGG - Intergenic
1009553137 6:65125835-65125857 TTTTCTGAAGAGAGGAAGGCAGG - Intronic
1011370216 6:86629128-86629150 TTTTCTTAAAAGGGGATGAAAGG + Intergenic
1014246318 6:119073625-119073647 GTGTCTTCAAGGGGGAAGGGTGG + Intronic
1014815121 6:125926973-125926995 TTTTCTTATCGGGGGATGGAAGG - Intronic
1016029436 6:139322520-139322542 TTTTCTATAATGGGGAAGACTGG - Intergenic
1018078736 6:160240175-160240197 TTTCCTTAAAGTAGGGAGGCAGG + Intronic
1018320898 6:162607547-162607569 TTTTTTTAATGGGGGAAACCTGG + Intronic
1018746465 6:166765877-166765899 TTTTCTGAACAGGGGAAGGGAGG + Intronic
1021474977 7:21050508-21050530 TTTTCATAAATAGGTAAGGCAGG + Intergenic
1022109818 7:27221851-27221873 CTTTCTTAAAGAGGGAAGAATGG - Intergenic
1022109977 7:27223240-27223262 GTTTCTTAAAGAGGGAAGAATGG + Intergenic
1022288846 7:28981280-28981302 TGTTCTAAAATGGGAAAGGCTGG + Intergenic
1023393621 7:39732954-39732976 TTTTCCTAACGGGGGAGGGTGGG - Intergenic
1023973279 7:45007752-45007774 TTTTCTGAAAGTGAGAAGACTGG + Intronic
1024115540 7:46189605-46189627 TCTTCTGATAGGAGGAAGGCAGG - Intergenic
1026052209 7:66956691-66956713 TTTTTTTGGAGGGGGGAGGCAGG + Exonic
1026661386 7:72305765-72305787 TTTTCTTATAGCCTGAAGGCTGG + Intronic
1028659469 7:93252642-93252664 TTTTCTTAAAGGAAGAATTCAGG + Exonic
1028684944 7:93581603-93581625 TTTTTTAGAAGGGTGAAGGCAGG - Intergenic
1029680784 7:102107682-102107704 TTTTCATAGAGGGAGAAAGCAGG + Intronic
1030093297 7:105876582-105876604 TGTTCTGAAAGGGGGAGGGAGGG + Exonic
1030292146 7:107883479-107883501 TTTTCTTAAAGGAGTGAGGGCGG + Intergenic
1030436148 7:109523231-109523253 GTTTCCAAAAGGGGGAAGGGTGG + Intergenic
1030507618 7:110444815-110444837 CTTTTTTGAAGGGGGATGGCTGG - Intergenic
1032079362 7:128851004-128851026 TTTGTTGAAAGAGGGAAGGCAGG - Intronic
1034596375 7:152197381-152197403 TTTACTTAAAAGGGGGAGGAGGG + Intronic
1034604600 7:152300483-152300505 TTTTCGTTAAGGGGGAAAGAAGG + Intronic
1034712609 7:153207197-153207219 TTTTCTGAAGTGGGGGAGGCTGG + Intergenic
1034881271 7:154764408-154764430 TCTCCTTAAAGGCGGAAGACAGG + Intronic
1036180743 8:6582670-6582692 TTTCCTTGGACGGGGAAGGCAGG - Intronic
1036208602 8:6824012-6824034 TTTTCTTAAAGGGCGTAGAAAGG - Intronic
1036989983 8:13581394-13581416 TTTACTGAAATGGGGAAGGCTGG - Intergenic
1037100778 8:15042832-15042854 TTTTCTGCAAGTGGGAAGCCTGG - Intronic
1038757436 8:30354592-30354614 TTTTCTGAAAGGAGGAACACTGG + Intergenic
1038946944 8:32371842-32371864 TTTTCTAAAAATGGGAAGACTGG - Intronic
1041369158 8:57142039-57142061 TTTTCTCCTAGGAGGAAGGCGGG + Intergenic
1041784434 8:61616052-61616074 TTTTATTAAGGGGGAAATGCAGG - Intronic
1042468066 8:69151558-69151580 TTTTCTTAAGGGGGGAAGGCAGG + Intergenic
1043073495 8:75666758-75666780 TTTGCTAAAATGGAGAAGGCTGG - Intergenic
1043175758 8:77021681-77021703 TTTTCTAAAAGGTGTAAGGAAGG - Intergenic
1044888547 8:96807087-96807109 TTTTCTTAAATGGGGAAATAAGG + Intronic
1045168009 8:99628781-99628803 TTTTTTTTAAGGGGGCAGACAGG + Intronic
1045385365 8:101667031-101667053 TTCTCTTGAAGGGGGAACGCTGG - Exonic
1045439322 8:102193983-102194005 TTGTTTTAAAAGGGGGAGGCTGG + Intergenic
1045501327 8:102746500-102746522 TTTTCAGAAAAGGGCAAGGCTGG + Intergenic
1045903599 8:107315071-107315093 TCTTCTTAAAGGGGGAAATGAGG - Intronic
1046528401 8:115411908-115411930 GTTTCTTAAAGTTGGATGGCAGG - Exonic
1047470801 8:125170242-125170264 TTTTCTAAGATGGGGAAGTCAGG - Intronic
1047987463 8:130249576-130249598 ATTTCTTAATTGGGGAAGGGGGG - Intronic
1048082272 8:131141452-131141474 TTTTGCTAAAGGGAGAATGCTGG + Intergenic
1048601083 8:135919539-135919561 TTTTCTCAATGGGGGAAGTTAGG + Intergenic
1049173665 8:141177830-141177852 TTTTCTAGAAGGGGCTAGGCAGG - Intronic
1050693938 9:8259060-8259082 TTCACTTAAAGGGGCAAGGATGG + Intergenic
1051069336 9:13144722-13144744 TTTTCCTACAGAGGGAAGACAGG + Intronic
1051485241 9:17601421-17601443 TTTCTTTAAAGGATGAAGGCTGG + Intronic
1051701011 9:19823992-19824014 TTTTATTTAAGGTGTAAGGCAGG - Intergenic
1055728367 9:79256184-79256206 TTTTTTTAAAAAGGGGAGGCGGG + Intergenic
1056962050 9:91134070-91134092 TATTCATAAAGGAGGAAGGAAGG + Intergenic
1057413870 9:94844303-94844325 TTTTCTTAAAAGGGTATGGGGGG - Intronic
1059697264 9:116741143-116741165 TATTCTTAAAAGGGGGCGGCAGG - Intronic
1060008175 9:120018882-120018904 TTTTCTTTAGGAAGGAAGGCTGG - Intergenic
1203354386 Un_KI270442v1:118433-118455 TTTTGTTTAAGGTGGAAGGAAGG - Intergenic
1185888510 X:3803429-3803451 TTTTTGTAAAGGAGGAAGGAAGG - Intergenic
1185917239 X:4048882-4048904 TTTTCTTAAAGGGGGACAAGAGG + Intergenic
1186083384 X:5958154-5958176 GTTTGTTGATGGGGGAAGGCAGG + Intronic
1188322225 X:28753873-28753895 TTTTTTTAAGACGGGAAGGCTGG + Intronic
1188333591 X:28900274-28900296 TTTTCTGGAAGTAGGAAGGCGGG - Intronic
1190682665 X:52841550-52841572 TTTTATTAAAAAGGGAAGGGAGG + Intergenic
1191603541 X:63037146-63037168 TTTACATAAAGGGGGAAGGTGGG - Intergenic
1192425694 X:71074042-71074064 TTTTATTAAGGGAAGAAGGCTGG - Intergenic
1192437923 X:71154197-71154219 GTTTCTCCAAGGAGGAAGGCTGG - Intronic
1193950383 X:87789692-87789714 TGTGATTAAAGGTGGAAGGCAGG - Intergenic
1195585156 X:106556749-106556771 TATTCTTGAAGGGTGGAGGCTGG - Intergenic
1197259462 X:124302191-124302213 TTTGCATAAAGAGGGAAGGATGG - Intronic
1197284206 X:124576807-124576829 TTTTCTGAAAAAGGGAAAGCAGG - Intronic
1198089732 X:133315985-133316007 TTTATTTAAAGGGGGAAGGGAGG - Intronic
1198674242 X:139115170-139115192 TTTACTGAGATGGGGAAGGCTGG - Intronic
1198932750 X:141878906-141878928 TTTTCTAAAATGGGGTGGGCAGG - Intronic
1199699845 X:150366946-150366968 TATTTTTAAAGGGGGAAAGGGGG - Intronic
1199916189 X:152343488-152343510 TTTTCTAAAATAGGGAAGACTGG - Intronic
1200306827 X:155034257-155034279 TTTACTTTAAGGTGGAAAGCAGG - Intronic
1201906455 Y:19090737-19090759 TCTTTTTAAAGGAGGAAGGAAGG + Intergenic