ID: 1170577448

View in Genome Browser
Species Human (GRCh38)
Location 20:17675138-17675160
Sequence TGCCCTTCCAGCGGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170577448 Original CRISPR TGCCCTTCCAGCGGAGGCTG GGG (reversed) Intronic
901087790 1:6622193-6622215 CGCCCTTCCAGGGGAGCCCGAGG - Exonic
901476475 1:9493511-9493533 TGCTCTTCCTGCTGTGGCTGTGG + Intergenic
902330334 1:15728205-15728227 TGCCGCTCCAGCGGGGGCGGTGG - Intronic
904657564 1:32060633-32060655 TGCCCTTCCATAAAAGGCTGAGG + Intronic
905365555 1:37449258-37449280 AGCAGTTCCAGCAGAGGCTGGGG - Intergenic
905516030 1:38562804-38562826 TGTCCTTACAGGGGAGACTGAGG - Intergenic
905910067 1:41647589-41647611 GGCCCTTCCAGGGCACGCTGAGG + Intronic
907487023 1:54785428-54785450 TGCCAATCCAGAAGAGGCTGGGG + Intronic
909530373 1:76675298-76675320 TTCCCTTCCAGGGTAGCCTGTGG - Intergenic
910337987 1:86155609-86155631 TGCCCCTCCTGCGGAGGTTTTGG - Intronic
910970767 1:92853500-92853522 TGCAATGCCAGCGGAGGCTTTGG + Intronic
911299708 1:96157282-96157304 TCCCCTCCCAGCTGGGGCTGGGG - Intergenic
915325434 1:155079333-155079355 TGCTATTCCAGCGGCGGGTGCGG - Intronic
915931416 1:160062804-160062826 TGCCCTTCCTGCTGGGGTTGGGG - Intronic
916455730 1:164969512-164969534 TGCCCTTCTAGGTGAGGGTGAGG + Intergenic
916806443 1:168265649-168265671 TGCCCTTCCAGCAGCAGCTGTGG - Intergenic
917099560 1:171431648-171431670 TGCTCTGCCAGTGGAGCCTGGGG + Intergenic
918962851 1:191302960-191302982 TGCTCTTACAGGGGAGGCTATGG + Intergenic
919290027 1:195617849-195617871 TGCTCTTCCAGAGGAAGCAGTGG + Intergenic
921075397 1:211696648-211696670 TGCCCTTACAGGGATGGCTGAGG - Intergenic
921925923 1:220710220-220710242 TGCCCATCCACCGGAGGCTAAGG - Intergenic
923099090 1:230798065-230798087 GGGCCTTCCAGTGGAGCCTGTGG - Intronic
1062843913 10:690085-690107 TGCGCGTCCAGCGGAGCCTGCGG + Intergenic
1063727636 10:8656056-8656078 TGCACTTCCAAAAGAGGCTGAGG - Intergenic
1064552999 10:16521260-16521282 TGCTCCCCCCGCGGAGGCTGCGG + Exonic
1067225439 10:44373235-44373257 TGCCCTGGCAGGGGAGGCTGTGG + Intronic
1069262423 10:66415055-66415077 TGCCCTGCCAGTGGGGGTTGAGG - Intronic
1069486620 10:68827802-68827824 TGGCCTTCCAGGGCTGGCTGCGG + Exonic
1069486707 10:68828138-68828160 TGGCCTTCCAGGGCTGGCTGCGG + Intronic
1073125591 10:101146882-101146904 TGCCCTGCGACCGGAGGATGGGG + Intergenic
1075402869 10:122173454-122173476 TGCCCTAACTGGGGAGGCTGTGG + Intronic
1075671280 10:124265526-124265548 GGCCCTCCCAGTGGAGGGTGTGG + Intergenic
1076175660 10:128366111-128366133 TAACTTTCCAGCAGAGGCTGTGG + Intergenic
1076294710 10:129375477-129375499 TGCCCTTGGAGCAGGGGCTGGGG + Intergenic
1076881940 10:133243852-133243874 TGCCCTTGATGCAGAGGCTGGGG + Intergenic
1080642737 11:34167171-34167193 TGCCCACTCAGCTGAGGCTGGGG + Intronic
1083104557 11:60345596-60345618 TTTCCTTCCAGAGGAAGCTGGGG - Intronic
1083172881 11:60933529-60933551 TGCCCTTCCATAGGTGTCTGAGG + Exonic
1083805715 11:65072629-65072651 TGCCCCTCCAGTGGGAGCTGGGG - Intronic
1083861775 11:65423815-65423837 AGGCCTTCCCGCTGAGGCTGGGG + Intergenic
1085402164 11:76241668-76241690 CGCCCTTCCAGAGGATGCCGCGG - Intergenic
1088811161 11:113393631-113393653 TGAGCTTCCAGCAGAGGCTGTGG - Exonic
1089832764 11:121343273-121343295 TGCAGTCCCAGCTGAGGCTGAGG - Intergenic
1089968465 11:122673045-122673067 TGCCCAACCAGCGAATGCTGAGG - Intronic
1090299764 11:125625611-125625633 TGCGCTTCCAGGCGGGGCTGCGG - Exonic
1090649247 11:128791898-128791920 TGCCCATCAGGAGGAGGCTGAGG + Intronic
1091140700 11:133232003-133232025 CGTCCTTCCTGAGGAGGCTGGGG - Intronic
1091816866 12:3445298-3445320 AGCCCTCCCAGGGGAGGCAGTGG - Intronic
1091999396 12:5020050-5020072 TTCCCATCCCGCAGAGGCTGAGG + Intergenic
1092261022 12:6953404-6953426 GGCCCCTGCAGAGGAGGCTGAGG + Intronic
1092860574 12:12716743-12716765 TGCCATCCCTGGGGAGGCTGGGG - Intronic
1094288213 12:28817616-28817638 TGCCCTTCCAGCACCAGCTGTGG + Intergenic
1094587536 12:31791951-31791973 TGCCCTTCCAGAGGTTGGTGAGG - Exonic
1096093952 12:48922190-48922212 TGCCTCTCCAGCGGATGCAGTGG - Exonic
1098226725 12:68332216-68332238 TGCGCTTCAAGGTGAGGCTGGGG - Exonic
1100229142 12:92589531-92589553 TGCTCCTCCAGAGAAGGCTGGGG - Intergenic
1101238422 12:102813480-102813502 TCCCCTTCCAGGGAAGGCTCTGG + Intergenic
1101807394 12:108076315-108076337 TACAGTTCCAGAGGAGGCTGGGG + Intergenic
1102783538 12:115585508-115585530 TGTCCTCCCAGCAGATGCTGAGG - Intergenic
1103562552 12:121800168-121800190 GGCCCTTCCCGGGGAGGGTGCGG - Intronic
1103925930 12:124423318-124423340 TGCTCTCCCTGCGAAGGCTGTGG - Intronic
1104105368 12:125654021-125654043 TTCCCTTCCATGGGAGACTGGGG - Exonic
1104741464 12:131177877-131177899 AGCCTTTACAGAGGAGGCTGGGG - Intergenic
1106667311 13:31865264-31865286 TGCCCTTCCAAAGGAAGCTGTGG - Intergenic
1108347229 13:49558295-49558317 TGCGCTGCCAGAAGAGGCTGTGG + Intronic
1108585478 13:51866581-51866603 TGCCCTACCAGAGGAGGAAGAGG - Intergenic
1111611676 13:90614807-90614829 TGCTCTTCCAGCAGCAGCTGTGG - Intergenic
1112268328 13:97946391-97946413 TGCCCATACACAGGAGGCTGAGG - Intergenic
1114634987 14:24182334-24182356 TGCCCTGGCAGCCGCGGCTGGGG - Exonic
1115630266 14:35237772-35237794 TGTAGTCCCAGCGGAGGCTGAGG - Intronic
1118082551 14:62377930-62377952 TTCCCTCCCAGCGTTGGCTGGGG - Intergenic
1118280522 14:64424137-64424159 TGCACTTCCAGGAGGGGCTGGGG - Intronic
1118598343 14:67453381-67453403 TGCCCTCCCAGCTGAGACAGAGG + Intronic
1119601132 14:75978194-75978216 TGACCTCCCAGCAGAGGCTCTGG + Intronic
1119962467 14:78875065-78875087 TGCTCTTCCAGCAGAGGCCCAGG - Intronic
1120049767 14:79851731-79851753 ATCTCTTCCAGTGGAGGCTGAGG + Intronic
1121665493 14:95668958-95668980 TCCCTATCCAGAGGAGGCTGGGG - Intergenic
1122174656 14:99908118-99908140 TGCCCTTCCTGCGGCTGCAGGGG - Intronic
1122231226 14:100307059-100307081 GGCGCTTCCTGCGGAGCCTGAGG + Intergenic
1126099708 15:45111810-45111832 TGCCCTTCCAGAGGAGCCGCTGG - Exonic
1127792926 15:62414389-62414411 TGTCCTTCAAGTAGAGGCTGAGG + Intronic
1129456320 15:75677706-75677728 TGTTCTTCCAGAGGTGGCTGGGG + Exonic
1129832400 15:78679420-78679442 TGGCCTTCCTGGGCAGGCTGAGG + Intronic
1130234104 15:82118183-82118205 TGCCCTTCCAAGGGAATCTGTGG - Intergenic
1131945457 15:97615574-97615596 TGCACCTACAGGGGAGGCTGAGG - Intergenic
1132198049 15:99928631-99928653 TGGCCTTCCAATGCAGGCTGCGG + Intergenic
1132461179 16:55705-55727 TTTCCTGCCATCGGAGGCTGTGG + Intronic
1132677344 16:1126264-1126286 TGACATTGCAGCAGAGGCTGAGG + Intergenic
1132712897 16:1277133-1277155 TGTCCTGCCAGCCCAGGCTGCGG - Intergenic
1133006242 16:2883296-2883318 GGCCCTTGGCGCGGAGGCTGAGG + Exonic
1133125057 16:3641295-3641317 TGCGATTCCTGGGGAGGCTGAGG + Intronic
1135795108 16:25434067-25434089 TGTAATCCCAGCGGAGGCTGAGG - Intergenic
1138738616 16:59280843-59280865 TGCACTTCCCCTGGAGGCTGAGG + Intergenic
1139630391 16:68228313-68228335 TGCCCCTCCAAAGGAAGCTGTGG - Exonic
1142172138 16:88628448-88628470 TGCCCTTCCAGCAGAGGACAGGG - Intronic
1142176564 16:88648021-88648043 TATCCTTCCACCTGAGGCTGGGG - Intronic
1142317955 16:89361060-89361082 TGCCATTGCAGCAGGGGCTGGGG - Intronic
1142547557 17:715120-715142 TGCGCTGCCCGCGGAGGCTGTGG - Intronic
1143465730 17:7134933-7134955 GGCTCTTCCAGGGGTGGCTGAGG - Intergenic
1145812249 17:27771432-27771454 GGCCCACCCAGCGGAGGATGGGG + Intronic
1145901407 17:28492840-28492862 TGCCCTTCCTGCCCAGGCAGTGG + Intronic
1145976458 17:28986865-28986887 TGCCCTTCCAGAGGCTGCGGTGG - Intronic
1146275946 17:31515679-31515701 TGCCCTGCCAGCCCTGGCTGAGG + Intronic
1147217340 17:38908488-38908510 GCCCCTCCCAGCGGATGCTGGGG + Intronic
1147427024 17:40350775-40350797 TGTCCTGCCACAGGAGGCTGGGG + Intronic
1150161412 17:62901288-62901310 TGCCGCTCCAGAGGTGGCTGTGG + Intergenic
1151317983 17:73335589-73335611 TGGGCTTCCAGCTGTGGCTGGGG + Exonic
1151389580 17:73776999-73777021 AGCGCTTTCAGAGGAGGCTGTGG - Intergenic
1151707559 17:75778873-75778895 TGCCCTTCCAGAGGTTGGTGAGG - Exonic
1151756142 17:76076334-76076356 TGCCCTCTCAGTGGAGACTGTGG + Intronic
1151804867 17:76399028-76399050 TGCCCTTTCCGCGGAGGGGGTGG - Intronic
1152625210 17:81385009-81385031 GGGTCTTCCCGCGGAGGCTGGGG + Intergenic
1155159481 18:23184050-23184072 TGCCCTTCCAGCCAAAGATGAGG - Intronic
1157497532 18:48166968-48166990 TGTGCTTCCAGCTGAGGTTGAGG - Intronic
1157773879 18:50375116-50375138 TGGGCTTCCAACGGAGACTGCGG + Exonic
1161003011 19:1920634-1920656 TCCCCCTCCTGCAGAGGCTGTGG + Intronic
1161118550 19:2512710-2512732 TGCCCTGGCAGCGGGGGCTCGGG + Exonic
1161326149 19:3665161-3665183 TGCCCTTCCTGAGGAGGCAGAGG - Intronic
1163675086 19:18651688-18651710 TGTCCTGCCAGTGGAGGCAGTGG + Intronic
1164222058 19:23203839-23203861 TGTCCTTCCCGCGGTGGCAGTGG + Intergenic
1164858437 19:31543515-31543537 AAGCCATCCAGCGGAGGCTGGGG + Intergenic
1165794369 19:38510484-38510506 TGCCCTCCCTACAGAGGCTGTGG + Exonic
1167045092 19:47045193-47045215 TTCCCTTCCGTCGGAGGCTCCGG - Exonic
1167521414 19:49958331-49958353 AGGCCTTACAGCGGAGCCTGAGG + Exonic
1167607518 19:50489411-50489433 TGCCCCTCCAGCTGAGGAGGGGG + Exonic
926058259 2:9789400-9789422 TGTCCTTCCAGCTGGGCCTGGGG - Intergenic
927986918 2:27418061-27418083 TGTCCTTCCAGTGGGGGGTGGGG + Intergenic
928666897 2:33558661-33558683 TTCACTTCCAGCGCAGGATGAGG + Exonic
934620307 2:95799502-95799524 TGCCCCTCTAGTAGAGGCTGTGG + Intergenic
934640586 2:96025061-96025083 TGCCCCTCTAGTAGAGGCTGTGG - Intronic
939983802 2:148811423-148811445 TGGCAATCCAGGGGAGGCTGAGG - Intergenic
941806095 2:169713300-169713322 TACCCTTCCAGCAGCAGCTGTGG - Intronic
942251051 2:174047965-174047987 TGCACATCCGGCGGGGGCTGAGG - Intergenic
944264186 2:197706064-197706086 AGCCACTCCAGCGGTGGCTGCGG + Exonic
945306765 2:208266356-208266378 AGCCGTTGAAGCGGAGGCTGGGG + Exonic
946612380 2:221473128-221473150 TGCCGTTTCAGGGGAGCCTGGGG + Intronic
946929162 2:224655518-224655540 TGCCCCTCCGGAGGCGGCTGAGG - Intergenic
948604604 2:239126847-239126869 GCCCCTTCCAGCTGAGGCTGGGG + Intronic
948953325 2:241269458-241269480 CGCCTTTCCAGCAGAGGATGTGG + Intronic
1169748193 20:8964250-8964272 TGACCTTGTAGCTGAGGCTGGGG + Intronic
1170012159 20:11736058-11736080 TGCCATGCTGGCGGAGGCTGGGG - Intergenic
1170577448 20:17675138-17675160 TGCCCTTCCAGCGGAGGCTGGGG - Intronic
1173433604 20:43012994-43013016 TGTCCTTCCAACAGAGCCTGAGG - Intronic
1174146435 20:48455635-48455657 AGCCCTTCAACCAGAGGCTGAGG - Intergenic
1175809409 20:61849675-61849697 TGCCCTTCAGGGGGTGGCTGTGG - Intronic
1177651308 21:23964752-23964774 TGCCCTTCCAGCAGCAGCTGTGG - Intergenic
1178193874 21:30319926-30319948 TGCCCTACCAGCGTGAGCTGTGG - Exonic
1179839743 21:44063700-44063722 TGCTCTTCCTGCAGAGGCCGTGG + Exonic
1179956281 21:44740946-44740968 TCCCCTCCCAGCTGGGGCTGGGG + Intergenic
1182070918 22:27463050-27463072 GGCACATCCAGCAGAGGCTGAGG + Intergenic
1184902540 22:47456787-47456809 TCTTGTTCCAGCGGAGGCTGTGG - Intergenic
1185280764 22:49968948-49968970 TGGCCTTCCAGGGGAAGATGGGG - Intergenic
950938820 3:16872870-16872892 TGTTCTTCCAGGGGAGCCTGAGG + Intronic
951164251 3:19466048-19466070 TGCCCGTGCATGGGAGGCTGAGG - Intronic
952526142 3:34212311-34212333 TGCCCTGCCAGGTCAGGCTGAGG + Intergenic
952931140 3:38361834-38361856 AGCCCTCCCAGCAAAGGCTGGGG + Intronic
954653965 3:52182625-52182647 TGCCCTGCCAGGGCAGGCAGGGG + Intergenic
958798831 3:98733239-98733261 TGCCCTCTCGGCGGTGGCTGCGG - Intronic
958973430 3:100638455-100638477 TTCCCTACCAGCTGAGTCTGGGG + Intronic
961609327 3:128123971-128123993 GGCGCTTCCTGCCGAGGCTGGGG + Intronic
963081788 3:141402094-141402116 TGTCCTCCCTGAGGAGGCTGAGG + Intronic
963601261 3:147380846-147380868 TGCCCTTCCTAAGGAGGCCGGGG - Intergenic
966899206 3:184468159-184468181 TGCTTTGCCTGCGGAGGCTGCGG - Intronic
967896047 3:194396972-194396994 GGCCCTTCCTGGGGTGGCTGCGG - Exonic
968148729 3:196320633-196320655 TTCCCTTCCAACAGAGCCTGGGG + Intronic
969682608 4:8651759-8651781 TCCCCTACGAGAGGAGGCTGGGG + Intergenic
971166913 4:24193425-24193447 TGCCCTTCTAGGGAAGGCTGGGG - Intergenic
972573515 4:40331222-40331244 CTGCCTTCCAGCGGAGGCTCTGG - Intergenic
974175004 4:58310173-58310195 TGCACTGCCAGTGGAGCCTGGGG + Intergenic
974345869 4:60680226-60680248 TGACCCTGCAGTGGAGGCTGGGG - Intergenic
974346125 4:60683491-60683513 TGACCCTGCAGTGGAGGCTGGGG - Intergenic
976431959 4:84972518-84972540 TGTAATTCCAGCTGAGGCTGAGG + Intergenic
977570039 4:98619891-98619913 TGCCCTTATAACTGAGGCTGGGG - Intronic
978381689 4:108135499-108135521 ATCCCTTCCAGTGGAGGCTCAGG + Intronic
978559961 4:110022540-110022562 GGCCCTTTCAGCAGAAGCTGTGG + Intergenic
981453740 4:144929704-144929726 TGCCCATTCAGTGGTGGCTGTGG + Intergenic
985629734 5:1008388-1008410 GGCCCTTCCAGCCGGGGCCGGGG + Intergenic
986710768 5:10486570-10486592 CGCCCTCCCATCGGAGGCTCTGG - Intergenic
990689015 5:58341152-58341174 TGCCTTTCCAGCAGAGGGAGTGG + Intergenic
993036223 5:82760610-82760632 TGCTCTGCCAGTGGAGCCTGGGG - Intergenic
996735509 5:126754892-126754914 TGTACTTCCAGCTGAGGCTGAGG - Intergenic
997442617 5:133919275-133919297 TGCCCTTCCACCTGGGGCAGGGG + Intergenic
998135387 5:139671607-139671629 TCTGCTTCCTGCGGAGGCTGCGG + Intronic
998465619 5:142341566-142341588 AGCCCTCCCAGCAGAGGCAGAGG + Intergenic
999901867 5:156094066-156094088 TGCCCTTCCAGAGTATGATGAGG - Intronic
1001651810 5:173321093-173321115 TGCATTTCCAGAGCAGGCTGGGG + Intronic
1002277631 5:178113990-178114012 TGCCCCTCCAGCGGAGCATCGGG - Intronic
1002681609 5:180969610-180969632 TGCCCCGCCAGAGGCGGCTGAGG + Intergenic
1006164925 6:32058480-32058502 TGCCCCTCCAGAGCAGGCTGAGG + Intronic
1007412543 6:41673390-41673412 TGCTATTCCAGCTGAGGCTCTGG - Intergenic
1007662683 6:43496334-43496356 TGCCCCTCCAGAGGAGCCCGGGG - Intronic
1010378435 6:75201897-75201919 GGACCTTCCCGCGGAGGCAGTGG - Intronic
1011260362 6:85464406-85464428 TGCCATTCCAGAGGAAACTGCGG + Intronic
1011470338 6:87701852-87701874 TGCCCCTGCCGCGGAGGCAGCGG - Exonic
1011590537 6:88966360-88966382 TCCCCTCCCAGCTGGGGCTGGGG + Intergenic
1012692744 6:102335239-102335261 TGCTCTGCCAGTGGAGTCTGGGG + Intergenic
1014969095 6:127792018-127792040 TGCCCTCCCAGGGGCAGCTGTGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1017036016 6:150268020-150268042 CGCTCTTCCACCGGAGGCTATGG - Intergenic
1019289920 7:245414-245436 TCTCCTTCCAGTGGAGGCAGGGG + Intronic
1019362265 7:610999-611021 GGCCCTTCCTGCGGGGGCCGAGG + Intronic
1019581104 7:1763599-1763621 TGTCCTTCCAGCTGGGGGTGAGG - Intergenic
1023075100 7:36474092-36474114 TGCCCTCCCAGCAGCAGCTGCGG - Intergenic
1024491079 7:49986398-49986420 TTCCCTCCCAGCTGGGGCTGGGG + Intronic
1024657859 7:51467081-51467103 TGCCCTGTCTGCAGAGGCTGCGG - Intergenic
1025607117 7:63047402-63047424 TGGCCTCCCAGGGCAGGCTGGGG - Intergenic
1026169107 7:67937372-67937394 TGCAATCCCAGCTGAGGCTGAGG + Intergenic
1029425105 7:100489843-100489865 TGCCCCTCCAGCGCACACTGGGG - Intronic
1029495174 7:100892659-100892681 TGACCTGGCAGCCGAGGCTGTGG - Exonic
1029618720 7:101676676-101676698 TGTCCCTCCAGGCGAGGCTGGGG - Intergenic
1031515026 7:122690044-122690066 TGTCCTTCCAGCAGCAGCTGCGG - Intronic
1031679477 7:124653287-124653309 TGCCTTTCCAGGGGTGGGTGGGG - Intergenic
1032087125 7:128890424-128890446 TGCCCTCCCAGCAAAGGCAGAGG + Exonic
1032708360 7:134441523-134441545 TGCCCCTCCAGCGCTGGGTGAGG + Intergenic
1038581227 8:28750969-28750991 GCCCCTTCCAGCAGAGGCTCTGG - Exonic
1040478035 8:47797922-47797944 TGCCCCTGCAGATGAGGCTGTGG - Intronic
1041667165 8:60456856-60456878 AGCACTTCCAGTAGAGGCTGGGG + Intergenic
1045112257 8:98947248-98947270 AGCCCTTCCAGAGGAAGGTGTGG + Intronic
1046476967 8:114758013-114758035 TGCAGTCCCAGAGGAGGCTGAGG + Intergenic
1048228802 8:132616893-132616915 TGTCCTTCCACTGCAGGCTGGGG + Intronic
1049396805 8:142404713-142404735 TCCCCTTCAAGTGGAAGCTGGGG - Intergenic
1049740912 8:144240445-144240467 CCGCCTTCCAGCGGAGGCCGGGG - Intronic
1051862173 9:21638471-21638493 TGCCTTTCCAGAGGATGGTGAGG + Intergenic
1057517891 9:95737298-95737320 TGTCCGCCCAGAGGAGGCTGGGG - Intergenic
1060523462 9:124307644-124307666 TGCCCTGGCAGAGGAGCCTGAGG + Intronic
1061071576 9:128314025-128314047 TGCCCTTCCTCCTGGGGCTGTGG - Intronic
1061189756 9:129075504-129075526 TGCCATTTCAGTGGAGGCTGTGG - Intergenic
1061416201 9:130448191-130448213 TGCCCTCCCAGCAGCGGGTGGGG - Intronic
1061500891 9:131001270-131001292 TGCCCTTCCAGCCAAATCTGGGG - Intergenic
1062016359 9:134293204-134293226 TGTCCTTGCAGTGCAGGCTGGGG + Intergenic
1062610912 9:137373061-137373083 TGCTCTTCCAGCACAGCCTGAGG - Exonic
1185776285 X:2805221-2805243 TGGCCTCCCTGCGGAGACTGGGG + Intronic
1190618758 X:52264692-52264714 TGACCCTGCAGCTGAGGCTGTGG + Intergenic
1190952776 X:55162384-55162406 TGACCCTGCAGCCGAGGCTGTGG + Intronic
1190952892 X:55163153-55163175 TTACCTTGCAGCTGAGGCTGTGG + Intronic
1198286272 X:135194797-135194819 GTCCCGTCCCGCGGAGGCTGAGG - Intergenic
1200228769 X:154433726-154433748 TGCCCTTCCAGCAGGGGCTCTGG + Intronic
1201293720 Y:12446488-12446510 TGGCCTCCCTGCGGAGACTGGGG - Intergenic