ID: 1170579235

View in Genome Browser
Species Human (GRCh38)
Location 20:17685238-17685260
Sequence AAGGAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8450
Summary {0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170579228_1170579235 18 Left 1170579228 20:17685197-17685219 CCCAAGAGTTCCAGGTTGGAAGA No data
Right 1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG 0: 25
1: 106
2: 378
3: 1647
4: 6294
1170579229_1170579235 17 Left 1170579229 20:17685198-17685220 CCAAGAGTTCCAGGTTGGAAGAA No data
Right 1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG 0: 25
1: 106
2: 378
3: 1647
4: 6294
1170579230_1170579235 8 Left 1170579230 20:17685207-17685229 CCAGGTTGGAAGAAAGAAGAAGA No data
Right 1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG 0: 25
1: 106
2: 378
3: 1647
4: 6294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170579235 Original CRISPR AAGGAGAAGGAGAAGGAGAA GGG Intergenic
Too many off-targets to display for this crispr