ID: 1170580281

View in Genome Browser
Species Human (GRCh38)
Location 20:17693967-17693989
Sequence ACGGATTCCTTCAGCCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170580278_1170580281 -5 Left 1170580278 20:17693949-17693971 CCGACGGGCACGTCTTGGACGGA 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1170580281 20:17693967-17693989 ACGGATTCCTTCAGCCACTGGGG 0: 1
1: 0
2: 0
3: 11
4: 148
1170580272_1170580281 29 Left 1170580272 20:17693915-17693937 CCTGATGGGCAGTGGCAAGCGTT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1170580281 20:17693967-17693989 ACGGATTCCTTCAGCCACTGGGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170580281 Original CRISPR ACGGATTCCTTCAGCCACTG GGG Intronic
900103264 1:971758-971780 ACGGTAACCTTCAGTCACTGAGG + Intronic
902110923 1:14077570-14077592 ATTGATTCCTTCAGGCTCTGCGG + Intergenic
903249258 1:22040611-22040633 GCGGATTCCTTCAGCCCAGGAGG + Intergenic
905923014 1:41731595-41731617 ATGGCTTCCTCCAGCAACTGGGG - Intronic
909230270 1:73080209-73080231 ACGTATTCGTTCACCCATTGTGG - Intergenic
909437963 1:75666027-75666049 ATTAATTGCTTCAGCCACTGTGG + Intergenic
909596140 1:77408219-77408241 ACAAATTAGTTCAGCCACTGTGG - Intronic
911491904 1:98579665-98579687 ATGGATTAGTTCAGCCATTGTGG - Intergenic
911855488 1:102870695-102870717 ACAGATTCCTCCAGTCACTGTGG - Intergenic
912075549 1:105870896-105870918 GCGAATTAGTTCAGCCACTGTGG - Intergenic
912492017 1:110067696-110067718 ACTGTTTCCTCCGGCCACTGTGG + Intronic
912975739 1:114328702-114328724 ACAGATCCCCTCAGCCAGTGGGG + Intergenic
918276460 1:182957909-182957931 ACGGTTTCCGGCATCCACTGGGG + Intergenic
920012334 1:202877913-202877935 ACCGATGTCTCCAGCCACTGTGG + Intergenic
1062998821 10:1894520-1894542 CAGGATTCCTCCAGCCATTGAGG - Intergenic
1067665159 10:48271258-48271280 ACTGAGTCATTCAGCCAGTGGGG - Intronic
1068145568 10:53066200-53066222 ACGGATTGCTTAAGCCAAGGAGG - Intergenic
1069916082 10:71787974-71787996 GTAAATTCCTTCAGCCACTGTGG - Intronic
1071450447 10:85787899-85787921 ATGGATTCTGTGAGCCACTGGGG - Intronic
1071478263 10:86042993-86043015 AAGGATCCCTTGAGCCAGTGAGG + Intronic
1076373628 10:129969575-129969597 TCGGATTCCTTCGGTCACTTTGG + Intergenic
1076381812 10:130028656-130028678 AGGGATTCCTGCTGCCGCTGTGG + Intergenic
1078797291 11:14605135-14605157 GCGAATTAGTTCAGCCACTGTGG - Intronic
1079633903 11:22711831-22711853 AGGGCTTGCTGCAGCCACTGTGG - Intronic
1082680975 11:56169724-56169746 ATGAATTAGTTCAGCCACTGTGG + Intergenic
1082767554 11:57181340-57181362 GGGGATTCCAGCAGCCACTGAGG + Intergenic
1090664953 11:128908774-128908796 GCGGACTCCCTGAGCCACTGAGG - Intronic
1093886981 12:24473124-24473146 ACGGACTCCCTCAGACACTTTGG - Intergenic
1096426429 12:51507789-51507811 ATGGATTCATTCTGCCACTGAGG + Exonic
1098273717 12:68793132-68793154 ACTGTTTGCTTCAGCCAATGAGG + Intronic
1099662817 12:85587095-85587117 ACGAATTAGTTCAGCTACTGTGG + Intergenic
1101113812 12:101512059-101512081 ACATATTCCTTCTGCCACTCAGG - Intergenic
1101311465 12:103584419-103584441 ACAGAATCCTACAGCCACAGAGG + Intergenic
1102397347 12:112598092-112598114 ACGGTTGCCCTCAGCAACTGTGG - Intronic
1102961084 12:117093663-117093685 GAGGATTCCATCAGCTACTGCGG + Intronic
1103858022 12:123988059-123988081 TTGTAGTCCTTCAGCCACTGTGG + Exonic
1105295873 13:19087622-19087644 ACTGATTCCTTCAGGGACAGGGG + Intergenic
1106669664 13:31890934-31890956 ACTACTTCCTTCAGCCACTTTGG + Intergenic
1109924657 13:69120267-69120289 AGGGCTTGCTGCAGCCACTGTGG - Intergenic
1110559081 13:76890739-76890761 ACGGTTTCAGTCACCCACTGAGG + Intergenic
1113692799 13:112323654-112323676 GCAGATTCCTGCAGGCACTGGGG + Intergenic
1114420613 14:22579559-22579581 ACAGATTCATTCATCCACTTGGG + Intronic
1115496388 14:34008769-34008791 ATAAATTACTTCAGCCACTGTGG - Intronic
1117605726 14:57426902-57426924 AATGATTAGTTCAGCCACTGTGG + Intergenic
1117737774 14:58784982-58785004 AGACATCCCTTCAGCCACTGGGG - Intergenic
1121426536 14:93856290-93856312 ACAGATTTCACCAGCCACTGAGG + Intergenic
1121426811 14:93858100-93858122 ACTGATTTCATCAGCCACTGAGG + Intergenic
1123909911 15:24956057-24956079 ACGCATTTCTGCAGCCCCTGCGG - Intronic
1125228188 15:37420150-37420172 CCGTTTTCCTTGAGCCACTGTGG + Intergenic
1126526941 15:49666663-49666685 ACAAATTACTTCAGCCATTGTGG - Intergenic
1128224472 15:65992384-65992406 AGGGATTCCTGCAGCCCTTGAGG - Intronic
1132985851 16:2767218-2767240 CAGGATTCCTGCAGCCTCTGCGG + Exonic
1133006840 16:2887233-2887255 AAGGATTGCTTAAGCCAGTGGGG - Intronic
1137923807 16:52520043-52520065 TCAGTTTCCTTCAGCCATTGGGG - Intronic
1138231638 16:55341739-55341761 AAGGATTTCTGCACCCACTGGGG + Intergenic
1140313454 16:73871298-73871320 ACGACTTGCGTCAGCCACTGAGG + Intergenic
1142143299 16:88482203-88482225 ACAGATGCCCCCAGCCACTGGGG + Intronic
1142940449 17:3376451-3376473 AGGGCTTGCTGCAGCCACTGTGG + Intergenic
1146566753 17:33920077-33920099 ATAAATTCGTTCAGCCACTGTGG + Intronic
1153621418 18:6981906-6981928 ACAGATTCCTGCTGCCACTTTGG + Intronic
1155341577 18:24819080-24819102 TAGGATTCCTGGAGCCACTGTGG + Intergenic
1155912182 18:31516690-31516712 AGGGATCTATTCAGCCACTGTGG + Intronic
1155938026 18:31774594-31774616 ACGAAGACCTTCAGCCACTGTGG - Intergenic
1156087160 18:33419820-33419842 ATGCATTAGTTCAGCCACTGTGG + Intronic
1160898575 19:1415200-1415222 ACGAGTTCCTTCTGCCAGTGAGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1165791551 19:38495750-38495772 AAAAATTCCTACAGCCACTGTGG - Intronic
1168515170 19:57004689-57004711 TTGGATTCCTGCAGCCAGTGGGG - Intergenic
1168629801 19:57947751-57947773 ACGGCGACCTTCAGCCAATGAGG - Intergenic
925571883 2:5321260-5321282 ACAGATTCCCTCAGCCACACTGG + Intergenic
926133994 2:10323767-10323789 AGGGATTCTTCCAGGCACTGGGG + Intronic
926969032 2:18448058-18448080 ACAAATTAGTTCAGCCACTGTGG + Intergenic
928472727 2:31590092-31590114 AGGGCTTGCTGCAGCCACTGTGG - Intergenic
929145859 2:38706588-38706610 AAGGATTCCTTGAGCCAGGGAGG + Intronic
933400146 2:81785836-81785858 ACAAATTCCTCCAGACACTGAGG - Intergenic
940035372 2:149307232-149307254 ACAGATTCCATCAGCGACTGGGG + Intergenic
941322108 2:164068738-164068760 AATGATTACTTCAGCCACTTAGG - Intergenic
945384206 2:209177787-209177809 ACAAATTAGTTCAGCCACTGTGG - Intergenic
946005451 2:216520848-216520870 GCCGATGCCATCAGCCACTGAGG - Intronic
947432502 2:230043476-230043498 TGGGATTCCTTCACCCACTGGGG + Intronic
1170580281 20:17693967-17693989 ACGGATTCCTTCAGCCACTGGGG + Intronic
1172521643 20:35570719-35570741 GAGGATTGCTTGAGCCACTGAGG - Intergenic
1174257646 20:49270107-49270129 AGAGAATCCTTCAGCCACTGGGG - Exonic
1175801251 20:61802183-61802205 TCGGCTTCATTCAGCCCCTGTGG + Intronic
1177536304 21:22432370-22432392 ACAAATTAGTTCAGCCACTGTGG - Intergenic
1178132826 21:29592444-29592466 ATTGATTCATTCAGCCTCTGTGG + Intronic
1179827076 21:43972097-43972119 ACTGTCTCCTTCAGACACTGCGG - Intronic
1181986743 22:26805220-26805242 ACGGGTTAGTGCAGCCACTGCGG + Intergenic
1184590025 22:45476028-45476050 ACTGAGTCCTGCAGACACTGGGG + Intergenic
1184781233 22:46650671-46650693 AGGGCTTCCTTTAGCCTCTGTGG + Intronic
949659330 3:6259558-6259580 ACAAATTAGTTCAGCCACTGTGG - Intergenic
952963072 3:38604785-38604807 ACGGATGTCTTCAGGAACTGAGG - Exonic
956655011 3:71541003-71541025 ATTGTTTCCTGCAGCCACTGAGG + Intronic
958746788 3:98145513-98145535 ATAAATTACTTCAGCCACTGTGG + Intergenic
962113525 3:132476021-132476043 AAGGATTGCTTGAGCCAATGAGG - Intronic
964691735 3:159457695-159457717 ACAGCTTCAGTCAGCCACTGGGG - Intronic
965475371 3:169149211-169149233 ACCGATTGCTTCAGACAGTGCGG + Intronic
967504592 3:190239282-190239304 AGGGCTTGCTTCAGCCACTGTGG - Intergenic
968354287 3:198091123-198091145 ACTGATTCCTACAGATACTGAGG - Intergenic
969517454 4:7655538-7655560 AAGGCTTCCTTCAGCCTGTGGGG - Intronic
969637186 4:8376099-8376121 GCAGATTCGTTCAGCCACCGTGG - Intronic
970687320 4:18583271-18583293 ACTGATTCCTTCAGTCCCGGAGG - Intergenic
971021467 4:22540891-22540913 ACAAATTCCTTCAGCTTCTGAGG + Intergenic
971630401 4:28985642-28985664 ACGGTTTCAGGCAGCCACTGGGG - Intergenic
976011855 4:80498650-80498672 ATGAATTAGTTCAGCCACTGTGG + Intronic
976313451 4:83635140-83635162 ATAAATTCGTTCAGCCACTGTGG - Intergenic
977583626 4:98750707-98750729 GTGAATTACTTCAGCCACTGTGG + Intergenic
983303952 4:165962477-165962499 ATGTATTAGTTCAGCCACTGTGG + Intronic
983938665 4:173520697-173520719 CCAGAATCCTTCAGTCACTGAGG + Intergenic
985416714 4:189742499-189742521 AGGGCTTGCTTCAGCCACTATGG - Intergenic
987648874 5:20714316-20714338 ATGAATTAGTTCAGCCACTGTGG - Intergenic
987840618 5:23218754-23218776 ATGGATTCCTTAATCTACTGTGG + Intergenic
988746707 5:34147215-34147237 ATGAATTAGTTCAGCCACTGTGG + Intergenic
991504851 5:67314118-67314140 ACGAATTAGTTCAGCCACTATGG + Intergenic
992078630 5:73214452-73214474 AAGGAATCCTCCAGCTACTGAGG + Intergenic
992347238 5:75892141-75892163 ATGGATTCCTTTAGCCTCTGAGG - Intergenic
994859638 5:105171955-105171977 GCAAAATCCTTCAGCCACTGTGG + Intergenic
997768147 5:136525855-136525877 CAGGATGCCCTCAGCCACTGTGG - Intergenic
999853402 5:155567200-155567222 AAGGATTCCTTGAGCCAAGGAGG - Intergenic
1001990889 5:176114533-176114555 CAGGAGTCCTTCAGCCTCTGGGG + Exonic
1002225985 5:177723607-177723629 CAGGAGTCCTTCAGCCTCTGGGG - Exonic
1002267862 5:178047603-178047625 CAGGAGTCCTTCAGCCTCTGGGG + Exonic
1005259468 6:24042687-24042709 AGGGCTTGCTGCAGCCACTGTGG + Intergenic
1005544840 6:26855458-26855480 ATGAATTAGTTCAGCCACTGTGG + Intergenic
1006486153 6:34344098-34344120 AATGGTTCATTCAGCCACTGTGG + Intronic
1010396419 6:75397750-75397772 ACGGATTCCTTCATCTGTTGAGG + Intronic
1014500142 6:122178000-122178022 ATGGATTCCTTCAGTCCCTCAGG - Intergenic
1014750069 6:125245575-125245597 AGGGCTTGCTGCAGCCACTGTGG + Intronic
1015265563 6:131288746-131288768 ACGGTTTCAGGCAGCCACTGGGG - Intergenic
1015685493 6:135854718-135854740 GGGGATTCCTAGAGCCACTGAGG - Intronic
1017717389 6:157222358-157222380 ACAGATTCCTCTAGCCACAGAGG - Intergenic
1020676241 7:11188181-11188203 TGGGATTCATTCAGCCACTGTGG - Intergenic
1021589634 7:22247135-22247157 ACAAATTAGTTCAGCCACTGTGG + Intronic
1023564697 7:41512332-41512354 AAGGATTTCTGCAGACACTGTGG + Intergenic
1024423360 7:49196633-49196655 ATGAATTAGTTCAGCCACTGTGG - Intergenic
1028185475 7:87780215-87780237 ATGAATTAGTTCAGCCACTGTGG - Intronic
1029927735 7:104335319-104335341 AAGGATACCTACAGCCAGTGAGG + Intronic
1031117990 7:117688964-117688986 AAGGATACCTTCATCCATTGTGG + Intronic
1031688435 7:124761243-124761265 ACTGATTCCTCCAGCTGCTGGGG + Intronic
1034014160 7:147564077-147564099 AAGGATTCCTTGAGCCCCGGAGG + Intronic
1034852533 7:154508347-154508369 ATGGAGTCCTTCAGGGACTGGGG + Intronic
1035778450 8:2208543-2208565 ACTCATTCCTTCTGTCACTGTGG - Intergenic
1038464948 8:27753283-27753305 AGGGATTCATTCAGACCCTGGGG - Intronic
1041039270 8:53830065-53830087 ATGGGCTCCTTCAGCCAATGAGG + Intronic
1041595575 8:59647110-59647132 ACTGCTTCCTTCATCCACAGAGG + Intergenic
1048568757 8:135632241-135632263 ACGGATTCCCTCATCAAGTGTGG - Intronic
1050816548 9:9820072-9820094 ATAAATTACTTCAGCCACTGCGG - Intronic
1051546694 9:18283574-18283596 TCTCATTCCTTCAACCACTGTGG - Intergenic
1056551485 9:87656659-87656681 CATGATTCATTCAGCCACTGAGG - Intronic
1056790152 9:89620027-89620049 AGGGATTCCTTCAAGGACTGGGG + Intergenic
1058021548 9:100094880-100094902 AAGGATTGCTTCAGCCTCAGAGG + Intronic
1059275641 9:113094651-113094673 ACTGAGGCCCTCAGCCACTGGGG - Intergenic
1061935156 9:133853408-133853430 AAGGAATCCCTCAGGCACTGGGG + Intronic
1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG + Intronic
1193725577 X:85035044-85035066 ACAGATTAGTTCAGCCACTGTGG - Intronic
1196103594 X:111872914-111872936 ACAAATTAGTTCAGCCACTGTGG + Intronic
1197511944 X:127380630-127380652 ATGAATTACTTCAGCCATTGTGG - Intergenic
1199304750 X:146254529-146254551 ATGAATTAATTCAGCCACTGTGG + Intergenic
1199414723 X:147568177-147568199 GCAAATTACTTCAGCCACTGTGG - Intergenic
1201387624 Y:13459766-13459788 AAGGACAACTTCAGCCACTGAGG - Intronic