ID: 1170580859

View in Genome Browser
Species Human (GRCh38)
Location 20:17698523-17698545
Sequence CAGGTTATTCCACCTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170580852_1170580859 15 Left 1170580852 20:17698485-17698507 CCTGTGGGTCCTCTGGGACATGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1170580859 20:17698523-17698545 CAGGTTATTCCACCTGAGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 110
1170580855_1170580859 6 Left 1170580855 20:17698494-17698516 CCTCTGGGACATGGAACAGGACA 0: 1
1: 0
2: 2
3: 63
4: 1059
Right 1170580859 20:17698523-17698545 CAGGTTATTCCACCTGAGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 110
1170580849_1170580859 28 Left 1170580849 20:17698472-17698494 CCTACGGGTGGGTCCTGTGGGTC 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1170580859 20:17698523-17698545 CAGGTTATTCCACCTGAGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170580859 Original CRISPR CAGGTTATTCCACCTGAGCA GGG Intronic
902697654 1:18151016-18151038 CAGGGTATGTGACCTGAGCAAGG + Intronic
903967622 1:27100251-27100273 CAGACTCTTCCACCAGAGCAGGG - Exonic
911603334 1:99871178-99871200 CAGGTTATTTCAGCTGAGAAAGG + Intronic
915680461 1:157577059-157577081 CAGGTTAATCAACCAAAGCAAGG + Intronic
915968130 1:160330142-160330164 CATGCTATTCCAGCTGATCAGGG - Intronic
916034030 1:160905280-160905302 CAGAGAATTCCAGCTGAGCAGGG - Intergenic
916494792 1:165336679-165336701 CAAGATATTCCCCCTGAGCTGGG - Intronic
1063938396 10:11102929-11102951 GAGGTTGTTCCAACTGTGCAAGG - Intronic
1064026325 10:11851631-11851653 CAGATTATTCCGGCTGGGCATGG + Intronic
1066468111 10:35670926-35670948 CAGGTGATTAAACATGAGCAAGG - Intergenic
1068928637 10:62565747-62565769 CAGGTTATTCAACTGCAGCATGG + Intronic
1071745611 10:88415820-88415842 CAGGTTAACCCATCTGTGCATGG - Intronic
1072531545 10:96324012-96324034 CAGGTTCTGGCACCTGTGCAGGG - Intronic
1074524711 10:114253341-114253363 CCGCTTATTACACCTGACCAGGG + Intronic
1075003882 10:118817036-118817058 CAGGCCCTTCCACCTGAGCAGGG + Intergenic
1076352347 10:129825893-129825915 CAGGCTATCCCACCTGGGGAGGG + Intergenic
1076352366 10:129825943-129825965 CAGGCTATCCCACCTGGGGAGGG + Intergenic
1078388314 11:10912576-10912598 CAAGTTATTAAACCTGAGGAGGG + Intergenic
1078466770 11:11555775-11555797 CAGGCTATTCCACCTGGTCATGG - Intronic
1082230310 11:49757294-49757316 CAGGTAAATCCACATTAGCAAGG - Intergenic
1086619743 11:88871660-88871682 CAGGTAAATCCACATTAGCAAGG + Intronic
1089964326 11:122643319-122643341 AAGATTACTTCACCTGAGCAGGG - Intergenic
1090942697 11:131401998-131402020 CATGCTATTCCACAAGAGCAAGG - Intronic
1091810375 12:3391984-3392006 AAGGATATTGCTCCTGAGCAAGG + Intronic
1092565596 12:9662123-9662145 CAGGTCATGTAACCTGAGCATGG + Intergenic
1094006119 12:25753490-25753512 TAGTTTATTCCACAAGAGCAGGG - Intergenic
1094207878 12:27859767-27859789 CAAGTCATTCCACATGAGGAAGG - Intergenic
1095311084 12:40697889-40697911 CAGGTTACTCAGCCAGAGCAGGG + Intronic
1095484549 12:42671660-42671682 CGGGTCATTCCACCTGAAAAGGG - Intergenic
1097919684 12:65058264-65058286 CAGGTTTTTTCAAGTGAGCAAGG + Intronic
1099646029 12:85358023-85358045 CAGTTTATTCAACCAGAGAATGG - Intergenic
1101530505 12:105569134-105569156 CAGGTTGTTCCACCTGGCCAAGG + Intergenic
1103177403 12:118876725-118876747 CAAGTTATTTCACCTGTGTATGG + Intergenic
1103713300 12:122928929-122928951 TAGGTTTTTCCACCAGACCACGG - Intronic
1118382518 14:65229109-65229131 CAGGTCATTGCATCTGTGCAAGG + Intergenic
1128602619 15:69010621-69010643 CAGACAATTCCAGCTGAGCAGGG - Intronic
1130062227 15:80578293-80578315 CAGGTTCTGCCTCCTGACCAGGG + Intronic
1138440517 16:57031903-57031925 CTGGCTATTCCAGCTGTGCATGG + Intronic
1140454175 16:75095206-75095228 CGGGTCCTCCCACCTGAGCATGG - Intronic
1142644253 17:1301791-1301813 GAGGTAATTCCAGCGGAGCAGGG - Intergenic
1150443351 17:65209646-65209668 CAAGATATTGCACATGAGCAGGG + Intronic
1151568809 17:74915836-74915858 CAGGAGAGTCCCCCTGAGCAAGG - Intergenic
1156123034 18:33868079-33868101 CATGTCACTCCACCTGAGAATGG - Intronic
1156265278 18:35482513-35482535 CAGGTCTCTCCACCTGAGCCGGG + Intronic
1157121835 18:44918325-44918347 CAGGTCACTCCAGCTGAGCCTGG - Intronic
1159339060 18:67110855-67110877 AAAGTTATTCCCCCTGGGCATGG - Intergenic
1159639934 18:70851861-70851883 TAGGTAATTCCACCTATGCATGG + Intergenic
1161553517 19:4927824-4927846 CAGGTTTCTCGACCTAAGCATGG - Intronic
1161610860 19:5241780-5241802 CAAGTCCTGCCACCTGAGCAGGG + Intronic
1162042579 19:7979622-7979644 CATGGGATTCCACCTGAGCAGGG - Intronic
1164293441 19:23888040-23888062 CATGTTATTGCACTTGAGCCTGG - Intergenic
1165006505 19:32811962-32811984 CAGGTGATTCCACTGGTGCAGGG + Intronic
1165161900 19:33821182-33821204 CGGGTTCCTCCACCTGGGCATGG - Intergenic
928180065 2:29062589-29062611 CAGATTATTCCACCACAGAAGGG - Exonic
928289202 2:30022840-30022862 CTGGTTGGTCCCCCTGAGCAGGG + Intergenic
930722279 2:54649082-54649104 CAGGTTATTCCAGCTCAACCGGG + Exonic
931083329 2:58800482-58800504 CAGGTTATTCCACTGGAGACTGG + Intergenic
933765614 2:85706680-85706702 CAGGGTTTTCGGCCTGAGCAAGG - Intergenic
934089182 2:88536406-88536428 AAAGTTATTCCACCTCACCAGGG - Intergenic
935623582 2:105149679-105149701 AATATTATTCCACCTGAGGAAGG + Intergenic
940490672 2:154355166-154355188 CAGGCTATACAACCTGAGCTTGG - Intronic
943413422 2:187567732-187567754 CAGGTAATTCTAACTGATCATGG + Intergenic
948796381 2:240404419-240404441 CAGGTGATTCCACCTCAGCCGGG - Intergenic
1169240672 20:3977225-3977247 CAGGTTATTTCAGCAAAGCATGG + Intronic
1169490704 20:6069166-6069188 CAGATTATTACACCTGAGTCGGG + Intergenic
1170047208 20:12098084-12098106 CTGGTTGTGCCATCTGAGCAGGG - Intergenic
1170580859 20:17698523-17698545 CAGGTTATTCCACCTGAGCAGGG + Intronic
1170892758 20:20390157-20390179 CAGGTGGTGCCACCTGAGGAAGG + Intronic
1182078168 22:27509314-27509336 AATGTTATTCCACCTGAGTGGGG + Intergenic
1182589341 22:31366757-31366779 CAGGTTTTTCTACCTAACCATGG + Intergenic
949114122 3:298965-298987 CAGGTTATAGCACCTTAACACGG - Intronic
954289771 3:49643477-49643499 CAGGTTCTCCTATCTGAGCAGGG - Intronic
954294584 3:49667044-49667066 CAGGGTATGGCTCCTGAGCAGGG + Intronic
955055606 3:55453031-55453053 GAGGTCTTTTCACCTGAGCAAGG - Intergenic
956989643 3:74748544-74748566 ACAGTTATTCCACCTGAGGAAGG + Intergenic
960418739 3:117416753-117416775 AATGTTATTCAACCTGAGCTAGG - Intergenic
960725902 3:120669774-120669796 CAAATTATTCTACCTGAGCCAGG - Intronic
964400985 3:156298120-156298142 GAGTTTATTCCACCTCTGCAAGG + Intronic
966499800 3:180626469-180626491 CATGCTGTTCCACCTGAGAAAGG - Intronic
967027240 3:185575668-185575690 CAGACAATTCCAGCTGAGCAGGG - Intergenic
967697199 3:192545773-192545795 CAGGTAATTCCAACTGTGGATGG - Intronic
969927342 4:10597269-10597291 CAGGGAGTCCCACCTGAGCATGG + Intronic
971243924 4:24912379-24912401 CAGGTAATTCCACCTGGCCCAGG + Intronic
977086031 4:92600274-92600296 CATGTTATTAAACCTGAGCAAGG + Intronic
977145884 4:93439656-93439678 TAAATTGTTCCACCTGAGCATGG + Intronic
979977162 4:127211058-127211080 CAGCTTATTGGACCTGAGCCTGG - Intergenic
985588745 5:754045-754067 GAGGTTGTTTCCCCTGAGCACGG - Intronic
985603412 5:846484-846506 GAGGTTGTTTCCCCTGAGCACGG - Intronic
990441596 5:55851547-55851569 CAGCTTGTTCCACCTCAGCTGGG + Exonic
995844525 5:116479740-116479762 CAGCAGATTCCACCTGAGCATGG - Intronic
1000545536 5:162596430-162596452 CATGTTATTCCAGCTGAATAGGG - Intergenic
1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG + Intergenic
1005711102 6:28503564-28503586 CAGGTCATGGCACCTGGGCAGGG - Exonic
1006612732 6:35304338-35304360 GAGGATATTCCACCTGGTCAGGG + Intronic
1008317167 6:50058825-50058847 CAGGGTTTTCCACCTAAGGAAGG + Intergenic
1014222823 6:118815540-118815562 CAGGCTCTTCCACTTGCGCAAGG + Exonic
1015209031 6:130675385-130675407 CAGGTTATACCAATTGAGCTTGG - Intergenic
1015436627 6:133197248-133197270 GAGAATATTCCTCCTGAGCAAGG + Intergenic
1019615528 7:1957932-1957954 CAGGCTCCTCCAGCTGAGCAGGG - Intronic
1019938203 7:4269945-4269967 CAGGTGATTCCAACGCAGCAAGG + Intergenic
1020705460 7:11538426-11538448 CAGGCTATTGGACCGGAGCAAGG - Intronic
1022612081 7:31885983-31886005 AAGGTTATTCCCTCTGAGGATGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024541364 7:50477499-50477521 CAGCTTGTCCCAGCTGAGCATGG - Intronic
1033289047 7:140065850-140065872 AAGGTTTTTCCACCTGAAGAGGG + Intergenic
1033755144 7:144392301-144392323 AAGATTCTTCCACCTGAGGATGG + Intergenic
1041334817 8:56770203-56770225 CATTCTATTCCACCTAAGCAGGG - Intergenic
1042388563 8:68205444-68205466 CACCTTATTCACCCTGAGCAAGG - Intronic
1043992832 8:86777312-86777334 CAGGTTTTTACACTTGAGCCTGG - Intergenic
1044028631 8:87206479-87206501 CAGGTGATGCCACCAGTGCAGGG + Intronic
1048215184 8:132487451-132487473 CTGGTTATTAAACCTGTGCAGGG - Intergenic
1052193902 9:25689114-25689136 CAGAGTATACCACCAGAGCAAGG - Intergenic
1059366235 9:113788458-113788480 CAGGTTTCTGCTCCTGAGCAAGG - Intergenic
1059820504 9:117967330-117967352 CAGGTTATTCCAGCTGGGCATGG - Intergenic
1187414530 X:19081587-19081609 AAGGTTATAACAGCTGAGCAGGG - Intronic
1189234080 X:39474422-39474444 AAGGTTATGTAACCTGAGCAAGG - Intergenic
1189428276 X:40922667-40922689 CAGACAATTCCAGCTGAGCAGGG - Intergenic
1190773229 X:53532471-53532493 CAGTTTGTTCCCCTTGAGCAAGG + Exonic
1195363848 X:104109026-104109048 CAATTTATTCCACCTGAGAAGGG + Intronic
1197009802 X:121546603-121546625 CAGATTATTCCTGCTGAGCCTGG - Intergenic
1200396810 X:155995303-155995325 CAGGTTATTTAACCTTAGCTGGG + Intergenic