ID: 1170583988

View in Genome Browser
Species Human (GRCh38)
Location 20:17720301-17720323
Sequence TTATTCACAACAGCATAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170583986_1170583988 -6 Left 1170583986 20:17720284-17720306 CCATGTTCGTAGCAGTATTATTC 0: 1
1: 30
2: 365
3: 1254
4: 2479
Right 1170583988 20:17720301-17720323 TTATTCACAACAGCATAAGGTGG 0: 1
1: 0
2: 6
3: 74
4: 391
1170583985_1170583988 -5 Left 1170583985 20:17720283-17720305 CCCATGTTCGTAGCAGTATTATT 0: 2
1: 40
2: 430
3: 1502
4: 2975
Right 1170583988 20:17720301-17720323 TTATTCACAACAGCATAAGGTGG 0: 1
1: 0
2: 6
3: 74
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170583988 Original CRISPR TTATTCACAACAGCATAAGG TGG Intronic
902057093 1:13610172-13610194 TTATTCACAACAGCCAAAAGTGG - Intronic
903145182 1:21367332-21367354 TTATTCATAATAGCCTAACGTGG + Intergenic
905317730 1:37094276-37094298 TTATTCACAACTGGCCAAGGTGG + Intergenic
905903682 1:41600284-41600306 TGATTTACAACAGCCAAAGGTGG + Intronic
907578309 1:55548799-55548821 TTATTTACAAAAACAAAAGGTGG + Intergenic
907783922 1:57593427-57593449 TTATTCACAGTACCAAAAGGTGG - Intronic
908080725 1:60575316-60575338 CTATTCACAATAGCAAAAGCAGG + Intergenic
909423824 1:75497973-75497995 TTCTACACAACAAGATAAGGAGG + Intronic
910324261 1:85986636-85986658 ATTTTCACAACAGCATTATGAGG - Intronic
911053315 1:93690722-93690744 ATTTTCACAACAGCATCATGAGG - Intronic
913020220 1:114781709-114781731 TTATTGACAATAGCAAAAGGTGG - Intergenic
913027436 1:114858570-114858592 GTATTCAAAACTGTATAAGGAGG + Exonic
913265686 1:117041285-117041307 TTATTCACTAAAGCCAAAGGTGG + Intergenic
913313364 1:117527314-117527336 TTATTTACAAAAGCAGATGGAGG + Exonic
913578748 1:120204770-120204792 TTATTCACAGTGGCAAAAGGTGG - Intergenic
913629425 1:120693599-120693621 TTATTCACAGTGGCAAAAGGTGG + Intergenic
914560677 1:148816211-148816233 TTATTCACAGTGGCAAAAGGTGG - Intronic
914612157 1:149314004-149314026 TTATTCACAGTGGCAAAAGGTGG + Intergenic
915030268 1:152873907-152873929 TTTTTCACAACAGCATCTGTTGG - Intergenic
915183919 1:154087655-154087677 TTATTCATAATAGCCAAAGGTGG + Intronic
915793107 1:158696517-158696539 ATGTTCACAACAAAATAAGGAGG - Intergenic
916017063 1:160759554-160759576 GTATTCATAACAAAATAAGGAGG + Intergenic
916349116 1:163828880-163828902 TTAATAACAACCCCATAAGGAGG + Intergenic
916532606 1:165672183-165672205 TTATTCACAACAGCCAAAAGTGG + Intronic
917283465 1:173400985-173401007 GTATTCATAACAAAATAAGGAGG - Intergenic
920658439 1:207894118-207894140 TTATTCACATTAGCCTAAAGGGG + Intronic
920939045 1:210463568-210463590 TTATTCACAATAGCCAAAAGAGG - Intronic
921342809 1:214151498-214151520 TTATTCACAGCAGCCAAAAGTGG + Intergenic
922322029 1:224496940-224496962 TTATTCACAATAGCTGAAAGGGG + Intronic
922419925 1:225452508-225452530 TTATTCACAATAGCCAAAAGGGG + Intergenic
922911243 1:229219460-229219482 TTATTCACAACAACCAAAAGGGG + Intergenic
922969477 1:229723806-229723828 TTATTCACAATAGCCAAAGATGG + Intergenic
924313524 1:242772545-242772567 TTCTTGAAAACATCATAAGGTGG + Intergenic
1063374091 10:5541913-5541935 TAATTCAGAAGAGGATAAGGAGG + Intergenic
1064021393 10:11812167-11812189 TTATTCACAATACCAAAAGGTGG + Intergenic
1064420869 10:15189663-15189685 TCATTCAAATCAGCATAGGGTGG + Intergenic
1065886020 10:30077835-30077857 TTATTCACAACGGCCAAAGGTGG - Intronic
1066679598 10:37924433-37924455 CTATTCACAATAGCAAAATGTGG + Intergenic
1067666315 10:48282518-48282540 ATATTCATAACAAAATAAGGAGG + Intergenic
1067790688 10:49285223-49285245 TTATTCACAATAGCCAAAAGGGG + Intergenic
1068888708 10:62125814-62125836 TTATTCACAACGACCAAAGGTGG + Intergenic
1069727145 10:70587493-70587515 TTATTCACAATAGCCAAAGGTGG + Intergenic
1070556076 10:77528674-77528696 CTATTCACAATAGCCAAAGGCGG + Intronic
1070678947 10:78435304-78435326 TTCTTGACAACTGCAGAAGGAGG + Intergenic
1071602079 10:86963196-86963218 AAATTCACAGCAGCATAAGTGGG - Exonic
1072816182 10:98511755-98511777 TCATTCTCAACAGCTTCAGGAGG - Intronic
1072832065 10:98669451-98669473 TTATTCACAACAGCAAAGACAGG + Intronic
1073808098 10:107122029-107122051 ACATTCACAGCAGCATCAGGTGG - Intronic
1076773788 10:132681805-132681827 TTATTCACAACTGCAAAATGCGG + Intronic
1077336571 11:2007631-2007653 TTATTCAGTGCAGCATAAAGTGG + Intergenic
1077671359 11:4160677-4160699 TTATTCACAATAGCAAGAGGTGG - Intergenic
1078133300 11:8631476-8631498 TTATTAAGCAGAGCATAAGGAGG + Intronic
1078630450 11:12998596-12998618 TTATCCACAATAGCTAAAGGTGG - Intergenic
1079040843 11:17058210-17058232 TTATTCACAATATCCTAGGGAGG - Intergenic
1079311411 11:19369756-19369778 ATATTCACAACAACCTCAGGAGG - Intronic
1081005016 11:37725705-37725727 TTCTTCACAACAGCAGGAGCTGG - Intergenic
1082880181 11:58029424-58029446 TGCTTAACAACAGAATAAGGGGG - Intronic
1083611042 11:64004493-64004515 TTATTTACAGGAACATAAGGAGG + Intronic
1084329248 11:68420782-68420804 TTATTCACGACAACCAAAGGTGG - Intronic
1086274078 11:85104277-85104299 TTATTCATAACATCAAAAAGTGG + Intronic
1087498895 11:98925965-98925987 TTCTTCACAACAGCATTTAGTGG + Intergenic
1087734524 11:101816998-101817020 TTATTCACAGCTGCACAAGAAGG - Intronic
1087803260 11:102527274-102527296 TTATTTACAAAAACAGAAGGTGG + Intronic
1088388536 11:109288024-109288046 TTATTCTTAACAAAATAAGGAGG - Intergenic
1089410565 11:118238243-118238265 TTATTCTCAAAATCACAAGGAGG + Intronic
1089722307 11:120438000-120438022 ATATTCACAATAGCAAAAAGTGG - Intronic
1089904378 11:122023463-122023485 TTATTCACAACAGCCAACAGAGG + Intergenic
1090247592 11:125227654-125227676 TTATTCACAGCAGCCAAAAGTGG - Intronic
1090798810 11:130158185-130158207 TTGTACATAGCAGCATAAGGAGG - Intergenic
1090815851 11:130294597-130294619 TTATAAACAACAACATAATGGGG - Intronic
1090885356 11:130871348-130871370 TTAAACACAACTGCATAAAGTGG + Intergenic
1202819555 11_KI270721v1_random:62813-62835 TTATTCAGTGCAGCATAAAGTGG + Intergenic
1091602002 12:1923373-1923395 TGATTCACGACAGCAGAAGGTGG + Intergenic
1091789132 12:3261293-3261315 ATATTCACAACAGCTTAATATGG + Intronic
1091958126 12:4665507-4665529 TTATTCACAATAGCCAAAAGTGG - Intronic
1093310301 12:17573796-17573818 TTATTCACAATAGCAAAAGCTGG + Intergenic
1095739102 12:45587644-45587666 ATATTCATAACACCATAGGGAGG - Intergenic
1096035822 12:48469258-48469280 TTATCTACAACTGCATAAGATGG + Intergenic
1096507348 12:52102923-52102945 TTATTCACAACAGCCAAAATGGG + Intergenic
1096765740 12:53887615-53887637 TTTTACTCAACAGCAGAAGGAGG - Intergenic
1097508937 12:60511517-60511539 TTTTTCACAACAGCTTAAGTAGG - Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1099492963 12:83308359-83308381 TTCTTCACAGCAGCATGAGTAGG + Intergenic
1100357606 12:93846203-93846225 TTATTCACAATAGCCAAAGGTGG - Intronic
1102267950 12:111504742-111504764 TTATTTAATATAGCATAAGGTGG - Intronic
1102667494 12:114587952-114587974 TTATTCACAATAGCCAAAAGTGG + Intergenic
1103925109 12:124419382-124419404 TTATTCACAAGAACAGATGGTGG + Intronic
1104433891 12:128740275-128740297 TTATTCACAGTAGCAATAGGTGG + Intergenic
1105393866 13:20009839-20009861 TTATTCACAATAGTCAAAGGTGG - Intronic
1106232555 13:27832394-27832416 TTATTCACAATAGTCAAAGGTGG + Intergenic
1106430267 13:29674314-29674336 TTAGTCACAATAGCCAAAGGGGG - Intergenic
1107106766 13:36651782-36651804 TTATTTACAAAAGCAGATGGTGG - Intergenic
1107896805 13:44973153-44973175 TTATTCACGAAACCACAAGGGGG + Intronic
1108777204 13:53781167-53781189 TTATTCTAAACAGCATAAAGAGG + Intergenic
1109603337 13:64661132-64661154 TTATTCACATATGCATAATGAGG + Intergenic
1109643030 13:65216901-65216923 TTATTCACAAAATTAGAAGGAGG + Intergenic
1110715277 13:78695750-78695772 TTATTTACAACAGCAAAACCTGG - Intergenic
1112611193 13:100956295-100956317 TTGTTCACAATAGCCAAAGGTGG - Intergenic
1112631518 13:101166170-101166192 TTTTTCACAATAACAGAAGGTGG - Intronic
1113153071 13:107286324-107286346 TTATTCACAATAGAAAAAGATGG + Intronic
1114346444 14:21800342-21800364 TTACTCATGACAGCATCAGGAGG - Intergenic
1115205800 14:30902254-30902276 TTATTCATAACAGAATATGAGGG + Intronic
1115365809 14:32555866-32555888 TTATTCACAATAGCCAAAGGTGG - Intronic
1115401611 14:32967754-32967776 TTATGGACAACAGCATGTGGGGG + Intronic
1116307906 14:43282214-43282236 TTATTCTTAACAAAATAAGGAGG + Intergenic
1116604821 14:46977783-46977805 TTTTTCACAACAGCAGAAATTGG + Intronic
1116859769 14:49984535-49984557 TTATTCACAATAGCCAAAGATGG - Intronic
1117147958 14:52854496-52854518 TTAATTACATCAGCATCAGGGGG + Intergenic
1117654555 14:57941255-57941277 TTATTCACAATAGCCAAAGATGG + Intronic
1117804469 14:59476599-59476621 TTATTCTCAGGAGCTTAAGGAGG + Intronic
1119011979 14:71002781-71002803 TTATTCACAACAGCCAAAAACGG - Intronic
1119536167 14:75404007-75404029 ATATTCACAAAATCATCAGGTGG - Intergenic
1120232731 14:81857446-81857468 TTCTTCACAATACTATAAGGTGG + Intergenic
1120806369 14:88755538-88755560 TTATGTACATCAGCAGAAGGCGG + Intronic
1202828856 14_GL000009v2_random:4431-4453 TTACTCCCAAGAGCATATGGGGG - Intergenic
1124840321 15:33235462-33235484 CTTTTCTCAACAGCAAAAGGTGG + Intergenic
1125867066 15:43062206-43062228 TTATCCACAATAGCAGAAGGTGG + Intronic
1125913606 15:43464509-43464531 TTATTCACAATAGCCAAAAGGGG + Intronic
1127196266 15:56589624-56589646 CTATTCACAACAGCAAAAGGTGG + Intergenic
1127889400 15:63235277-63235299 TTATTCAATACAGTATAAAGAGG - Intronic
1127914038 15:63440997-63441019 ATCTTCACAACACCATGAGGTGG + Intergenic
1128529610 15:68435058-68435080 TTATTCACAATAACCTAAAGTGG - Intergenic
1128666969 15:69545435-69545457 TCATTCACAATAGCCAAAGGTGG + Intergenic
1130001278 15:80049291-80049313 TTATTCACAATGCCAAAAGGTGG - Intergenic
1130956953 15:88633830-88633852 TTATTCACAACAGCCAAGGGGGG - Intergenic
1131521718 15:93121274-93121296 TTATTCACAAAAACAGATGGTGG - Intergenic
1131616882 15:94025447-94025469 TTATTCACAATAGCCTAAAGAGG - Intergenic
1131695420 15:94872074-94872096 CTATTCATAACAGCCAAAGGTGG - Intergenic
1132154738 15:99487407-99487429 TAATTCACAGCAGCAGAAAGGGG + Intergenic
1133911037 16:10066849-10066871 TTATTCACAATAGCCAAAGGTGG + Intronic
1135948827 16:26892793-26892815 TTATTTACAAAAGCATGTGGTGG - Intergenic
1137066147 16:35846035-35846057 TTATTCACAATAGCCAAAGGTGG + Intergenic
1137658912 16:50186508-50186530 TTATTCACAACAGGTAAAGGGGG - Intronic
1138026496 16:53526304-53526326 CTATTCACAAGAGCCAAAGGTGG + Intergenic
1138213820 16:55185531-55185553 TTCTTCACAATAGCCAAAGGCGG + Intergenic
1138951993 16:61923575-61923597 TTATTCACAACAGTTCAAAGAGG - Intronic
1140461665 16:75145125-75145147 TTATTCACAATATCCAAAGGTGG - Intergenic
1141145614 16:81527852-81527874 TTATTCATAAAAGCCTAAGAAGG - Intronic
1141373630 16:83509517-83509539 TTATTTACAAAAGCAGATGGTGG + Intronic
1143318407 17:6050925-6050947 CTATTCACAATAGCCAAAGGTGG - Intronic
1143910138 17:10241806-10241828 TTATTCACAATAGCCAAAAGGGG - Intergenic
1144472603 17:15558150-15558172 TTATTCATAACATCATACGGTGG - Intronic
1144644310 17:16961310-16961332 ATATTCACAACAGCCAAAGGTGG + Intronic
1144923878 17:18786541-18786563 TTATTCATAACATCATACGGTGG + Intronic
1145204764 17:20977672-20977694 ATATTCACAACAGCCAAAGGTGG - Intergenic
1145276164 17:21432289-21432311 TTATTCATAACAGCCAAAAGGGG - Intergenic
1145314006 17:21718203-21718225 TTATTCATAACAGCCAAAAGGGG - Intergenic
1145712454 17:26990180-26990202 TTATTCATAACAGCCAAAAGGGG - Intergenic
1149265466 17:54923158-54923180 TTAGTCACAATAGCCAAAGGTGG - Intronic
1149503041 17:57169678-57169700 TTATTCACAATAGCCAAAAGGGG + Intergenic
1150297692 17:64022211-64022233 CTATTCACAATAGCCAAAGGTGG - Intergenic
1150297898 17:64023814-64023836 CTATTCACAATAGCCAAAGGTGG - Intergenic
1150317672 17:64183211-64183233 TTATTCACAATAGCCAAAAGTGG - Intronic
1151038096 17:70824259-70824281 TTTTCCACAAAAGCAAAAGGAGG + Intergenic
1151231836 17:72690525-72690547 TTATTCACATCACCAAAAGGTGG + Intronic
1151873890 17:76855351-76855373 TTACTCACAACAGCCAAAGGGGG - Intergenic
1152464891 17:80460612-80460634 TTATTCACAACAGCAAAAGCTGG + Intergenic
1152886343 17:82852797-82852819 TTATTCACAGCAGCCTACAGTGG - Intronic
1153004659 18:487035-487057 TTATTCATAACAGCAAAAAAAGG + Intronic
1153070175 18:1096553-1096575 TTATTTACAATATCAAAAGGTGG - Intergenic
1153399146 18:4663666-4663688 TTATTCACAATAGCATCAAAAGG + Intergenic
1153806255 18:8710617-8710639 TTTTTCACAAAAGTTTAAGGTGG + Intronic
1153906323 18:9664879-9664901 TTATTCACAGTAGCAAAAGGTGG - Intergenic
1153971637 18:10232311-10232333 TTATTCACAACACCAACATGTGG + Intergenic
1154048357 18:10929327-10929349 TCAGTCACAACAGCATATGTGGG - Intronic
1155199002 18:23501518-23501540 TTATTCACAACAGCCAAAGGTGG + Intergenic
1156052191 18:32951289-32951311 TTCTTCACAGCAGCATGAGAAGG - Intronic
1156402621 18:36753486-36753508 TTATTCACAATAGCTGAAAGTGG - Intronic
1157388544 18:47281212-47281234 TTATTCACAATAGCCAAAAGAGG - Intergenic
1157693969 18:49705997-49706019 TTATTCACAATAGCCAAAGGTGG - Intergenic
1157837128 18:50915114-50915136 TTATTAACAAAATCATAAAGAGG - Intronic
1158496701 18:57961553-57961575 ATATTCTCAACAGCATTATGGGG + Intergenic
1158887477 18:61841983-61842005 TTATTTACAAAAACATGAGGTGG + Intronic
1159006175 18:63014812-63014834 TTATTTGCAATAGCAAAAGGTGG - Intergenic
1159029592 18:63217616-63217638 TATTTCACAACATCATAAGGAGG - Intronic
1159304814 18:66626953-66626975 TTATTCACAATAGCAGAGGCGGG + Intergenic
1159577240 18:70194522-70194544 TTATTCACAACCGCCAAATGTGG + Intronic
1161641739 19:5428013-5428035 CGATTCACAACAGCCAAAGGCGG + Intergenic
1161882910 19:6969696-6969718 TTATTTACAAAAACAGAAGGTGG + Intergenic
1163682237 19:18689761-18689783 TGATTCACGACAGCCAAAGGTGG - Intronic
1163913716 19:20219472-20219494 GAAGTCACAACAGCATAAAGTGG + Intergenic
1166606269 19:44145953-44145975 TTATTCAGAACAGCAGAATGAGG + Intronic
1168229295 19:55018934-55018956 ATATTCATAACAGCAAAACGTGG - Intronic
1202643838 1_KI270706v1_random:123369-123391 TTACTCCCAATAGCATATGGGGG + Intergenic
925621979 2:5803197-5803219 TTAATCAAAAAAGCATAATGAGG - Intergenic
925923568 2:8654421-8654443 TTACTCACAACAGCCTTTGGAGG - Intergenic
926117151 2:10220655-10220677 TTATTCACAATAGTCAAAGGTGG + Intergenic
927714950 2:25345713-25345735 TTATTCACAATAGCCAAAAGTGG + Intergenic
929117241 2:38454890-38454912 TTGTTCACAACAGCCAAAAGTGG - Intergenic
929196998 2:39195229-39195251 TTATTCACAATGACAAAAGGTGG - Intronic
929622233 2:43366911-43366933 TTATTCACAATAGCCAAAGGCGG + Intronic
929753193 2:44738982-44739004 ATATTCAGGAAAGCATAAGGAGG + Intronic
929939397 2:46321306-46321328 TGATTCACAACACCCAAAGGTGG - Intronic
930439287 2:51386444-51386466 GTATTCACAACAAAATAAGGAGG + Intergenic
930644193 2:53886771-53886793 TTAGTCACAATAGCCAAAGGTGG + Intronic
931626884 2:64264332-64264354 TTATTTAAAACAGCAGGAGGTGG + Intergenic
934696147 2:96401870-96401892 TTATTCACAATAGCCAAATGTGG + Intergenic
934790246 2:97053688-97053710 TCATCCTCAACAGCATGAGGTGG + Intergenic
934816222 2:97328849-97328871 TCATCCTCAACAGCATGAGGTGG - Intergenic
934821474 2:97379635-97379657 TCATCCTCAACAGCATGAGGTGG + Intergenic
935191842 2:100784124-100784146 TTATTCACAACAGCCAAGAGGGG - Intergenic
935557225 2:104523139-104523161 TTATTCACAACTGCCAGAGGCGG + Intergenic
935583607 2:104781377-104781399 TTATTCACAACAGCCAAGGGTGG + Intergenic
935596045 2:104878513-104878535 CTTTTCACAAAAGCATAATGTGG - Intergenic
935641147 2:105291493-105291515 CTACTCACCACAGCCTAAGGTGG + Intronic
935840225 2:107101206-107101228 TTACTCTAAACACCATAAGGAGG + Intergenic
936243004 2:110804548-110804570 TTATTCACAATAGCAAAAAGGGG + Intronic
937963077 2:127478132-127478154 TTATTCACAATAGCCAAAGGTGG + Intronic
938368290 2:130753081-130753103 TTATTCACAATAGCCAAAGGTGG + Intergenic
939172309 2:138710333-138710355 TTATTCACAATTGCCAAAGGTGG - Intronic
939234460 2:139473342-139473364 TTATTCACAAAAACACATGGTGG + Intergenic
939382399 2:141452933-141452955 TTATTCAAAATAGCACAATGTGG + Intronic
939918305 2:148075988-148076010 TTATTTACAATAGAATAAGTTGG - Intronic
940248410 2:151645881-151645903 TTATACATATCATCATAAGGTGG - Intronic
942813152 2:180021139-180021161 TTATTCATAATATCATTAGGGGG - Intergenic
944219004 2:197283674-197283696 TTTTTCACAAAAGTTTAAGGTGG + Intronic
944596117 2:201262234-201262256 TTTTTCACAACAGAAAAATGGGG + Intronic
945031511 2:205668765-205668787 TTCTTCACAGCAGCATGAGAAGG - Intergenic
945197186 2:207247855-207247877 TTATTCTGAACAGCACCAGGAGG + Intergenic
945425847 2:209700264-209700286 TTATTTTCAACAGCAGCAGGTGG + Exonic
946469925 2:219949540-219949562 TTATTAAGAACAGCATCAGAAGG - Intergenic
946521887 2:220474799-220474821 TTTTTCTCAACAGCATAGAGTGG - Intergenic
947329164 2:229010395-229010417 CTAATCACAACAGCATGAGAAGG + Intronic
948553760 2:238793362-238793384 TTATTCACAATAGCCAAAAGGGG - Intergenic
1169866452 20:10205098-10205120 TTATTCACAATAGCCAAAGAGGG - Intergenic
1169966460 20:11223248-11223270 ATATTCACAACAACAAAAGGAGG - Intergenic
1170583988 20:17720301-17720323 TTATTCACAACAGCATAAGGTGG + Intronic
1171455211 20:25267053-25267075 TTATTCATAACAGCCAAAAGTGG + Intronic
1173756414 20:45520690-45520712 ATATTCATAACAAAATAAGGAGG + Intergenic
1174087464 20:48019336-48019358 TTACCCACAACAGCACAAAGGGG - Intergenic
1174758491 20:53183182-53183204 TTTTTCACATCAGCACAGGGTGG - Intronic
1175350378 20:58313784-58313806 TTATTTACAAAAGCAGGAGGCGG - Intronic
1176608038 21:8849259-8849281 TTACTCCCAAGAGCATATGGGGG - Intergenic
1176702355 21:10070735-10070757 TTATTCACAACAGCTTAAATTGG + Intergenic
1177521815 21:22236525-22236547 ATATTCATAACAAAATAAGGAGG - Intergenic
1178308033 21:31507019-31507041 TTATTCACAATAGCCAAAAGAGG - Intronic
1178470652 21:32889590-32889612 TTATTCACAACAGCCAAAGGTGG + Intergenic
1178624002 21:34200639-34200661 TTATTCACAAGAGCCAAAAGTGG - Intergenic
1178883199 21:36464741-36464763 TTATTCCCAACAACCTAATGTGG + Intronic
1178941720 21:36912197-36912219 TTATTCACAACAGCCAAGGCTGG + Intronic
1179416901 21:41205997-41206019 TCATTCACAATAGCAAAAGGTGG + Intronic
1179671485 21:42952410-42952432 TTATTCATAATATCCTAAGGAGG + Intergenic
1180696848 22:17756959-17756981 TTAGTCAAAGAAGCATAAGGAGG - Intronic
1180909405 22:19438425-19438447 TTATTCACAATAGTAAAATGCGG - Intronic
1181791151 22:25267462-25267484 TTATTCACAATAGCTAAATGGGG + Intergenic
1181826960 22:25524492-25524514 TTATTCACAATAGCTAAATGGGG + Intergenic
1182141223 22:27960270-27960292 TTATTCATAATAGCCAAAGGTGG + Intergenic
1182539564 22:31030953-31030975 TTATTAAGAAAACCATAAGGAGG - Intergenic
1182768546 22:32776438-32776460 ATATTCACAACAGCACTAGGAGG + Intronic
1183373055 22:37446303-37446325 TTGTTCACAATAGCCAAAGGTGG - Intergenic
1184338417 22:43869893-43869915 TTATTCATAACAGCAAAAACTGG + Intergenic
1184460058 22:44632690-44632712 CTATTCACAACAGCAAAATATGG + Intergenic
949419316 3:3848824-3848846 TTATTCAGAACTGCAAAAGAGGG - Intronic
949819892 3:8104758-8104780 ATATTCACAAGAGAATAAGCAGG + Intergenic
950477322 3:13222390-13222412 TTACTCACAATAGCCAAAGGTGG - Intergenic
950527117 3:13530835-13530857 TTACTCACAACAGCAAAAAATGG + Intergenic
951479202 3:23141687-23141709 TTATTCACAGGAACTTAAGGGGG + Intergenic
951834110 3:26961990-26962012 TTATTAAGAAAATCATAAGGAGG - Intergenic
951986564 3:28627824-28627846 GTATTCATAACAAAATAAGGAGG - Intergenic
952054584 3:29429220-29429242 ATCTTCACAACAGCACAATGAGG - Intronic
952264973 3:31776520-31776542 CTATTCACAATAGCCAAAGGTGG + Intronic
952473887 3:33685523-33685545 TTATTCACAACAGCCAAATGTGG + Intronic
952475459 3:33705114-33705136 TTATTCACAATAGTCAAAGGTGG + Intronic
952953207 3:38540948-38540970 TTATTCACAATAGCAAAAAATGG + Intronic
953258708 3:41316105-41316127 TTATTAATAATAGCAAAAGGGGG + Intronic
953278065 3:41523844-41523866 TTATTCACAACAGCCAGAAGTGG + Intronic
953630294 3:44609786-44609808 TTATTAACAATAGCAAGAGGTGG + Intronic
954932086 3:54292894-54292916 TTATCCACAATAGCCAAAGGTGG + Intronic
955381894 3:58445571-58445593 TTATTCACAAATCCAAAAGGTGG - Intergenic
957492336 3:80944588-80944610 CTATTCACAACAGCAGAAAGAGG - Intergenic
958492567 3:94796023-94796045 TTATTTACAAAAACAAAAGGTGG - Intergenic
958849440 3:99306218-99306240 CTATTCACAACAGCAAAGGCTGG + Intergenic
959856285 3:111162433-111162455 TTCTTCACATTAGCAAAAGGGGG - Intronic
960146273 3:114207165-114207187 TTATTCACAACAGCCAAAGGTGG - Intergenic
963568009 3:146954889-146954911 TTATTTACAACAGCAGGTGGTGG - Intergenic
964429380 3:156588871-156588893 TTATTCACAATAGCCAAAAGTGG - Intergenic
964478766 3:157121118-157121140 TTTTTAACAACAGCAAAAAGGGG - Intergenic
964560060 3:157984821-157984843 TTATTCATAATAGCCAAAGGTGG - Intergenic
964898775 3:161631225-161631247 TTAATAACCACAGCAAAAGGTGG + Intergenic
965708221 3:171531086-171531108 ATATTCATAACAAAATAAGGAGG + Intergenic
965774532 3:172214781-172214803 TTATTGACAACATCCTAACGTGG - Intronic
965992405 3:174836062-174836084 TCATTCACAATAGCAAAATGTGG + Intronic
966234487 3:177685973-177685995 TTATTAACAACATCATGGGGGGG - Intergenic
966280974 3:178228366-178228388 TTATTTACAATAGCTGAAGGTGG - Intergenic
966317291 3:178661901-178661923 GTCCTCACAACAGGATAAGGTGG + Intronic
966635361 3:182127433-182127455 TTATTCAGAACAGGATGAGGAGG + Intergenic
966846123 3:184131273-184131295 TTATCCACAATAGCAAAAGGGGG + Intergenic
967553154 3:190823488-190823510 TTATTAAGAAAATCATAAGGAGG + Intergenic
969212632 4:5699507-5699529 TTATTCACAATAGCCAAAAGTGG + Intronic
969324850 4:6436814-6436836 TTATTCACAAAAACAGGAGGTGG + Intronic
970196446 4:13555571-13555593 TTATTCAGAACAGCCATAGGAGG - Intergenic
970634015 4:17987483-17987505 TTATTCACAATAGCAAAAAGTGG - Intronic
971383606 4:26122883-26122905 TTATTTACAAAAGCAGATGGTGG + Intergenic
971434364 4:26604556-26604578 TTATTAACAATAGCCAAAGGTGG - Intronic
972003991 4:34075127-34075149 GCATTCTCAACAGCAGAAGGTGG - Intergenic
972433213 4:39004726-39004748 TTATTCATAACAGCAAAAAATGG - Intronic
974114051 4:57558990-57559012 TCATTCAGAACAGAATATGGTGG - Intergenic
975530959 4:75398973-75398995 TTATTTACAATAGCCAAAGGTGG + Intergenic
976020567 4:80619356-80619378 TTATTTAAAAAAGCATAAGAAGG - Intronic
976726430 4:88220244-88220266 TTATTTACAACAGCCAAAAGTGG - Intronic
977108167 4:92916782-92916804 CTATTCACAACAGCAAAACTTGG - Intronic
977464688 4:97369097-97369119 TTATTCACAATAGCCAAAAGTGG - Intronic
977841115 4:101706426-101706448 TTTTTTAAAACAGCATCAGGTGG + Intronic
978499736 4:109396506-109396528 TTATTCACAATAGCCAAAGGTGG + Intergenic
978526801 4:109675799-109675821 TTATGCACAACAGCACAAGAAGG - Intronic
978865963 4:113511911-113511933 TTATTTACAACTGCATTAAGTGG - Intronic
978929532 4:114294178-114294200 TTATTCACAACAGTTAAAAGAGG - Intergenic
978940518 4:114430674-114430696 TTTTTCAGTACAGTATAAGGAGG + Intergenic
979263346 4:118673108-118673130 TTATTCATAACAGCAAAAACTGG + Intergenic
979263443 4:118674040-118674062 TTATTCATAACAGCAAAAACTGG + Intergenic
979283562 4:118895369-118895391 TTATTCATAACTGAATGAGGTGG + Intronic
979552742 4:122009607-122009629 CTATTTACAAAAGCATAAGCTGG + Intergenic
979595445 4:122529538-122529560 ATATTCATAACAAAATAAGGAGG + Intergenic
980273930 4:130623339-130623361 TTATTCATAGCAGCATTAGAAGG + Intergenic
980374527 4:131927150-131927172 TTATTCATAACAGCTTAAATTGG + Intergenic
980582082 4:134768751-134768773 ATATTCATAACAAAATAAGGAGG + Intergenic
983339238 4:166436426-166436448 ATATTCATAACAAAATAAGGAGG - Intergenic
983475111 4:168203773-168203795 TTTTTCACAGCACCATTAGGCGG - Intergenic
985003118 4:185505301-185505323 TTATTCACAATAGCCCAAAGAGG - Intronic
986007845 5:3683184-3683206 TTCCTCACAACAGCTAAAGGAGG - Intergenic
986240874 5:5958584-5958606 TCATTCACAACAGCCATAGGAGG - Intergenic
987324208 5:16797541-16797563 CCATTCACAACAGCCAAAGGTGG + Intronic
988869928 5:35378035-35378057 TTATTAACAAAATCATAAGGGGG - Intergenic
990566746 5:57037327-57037349 GTATTCACAATTGCATATGGTGG + Intergenic
991301811 5:65135659-65135681 TTATTCGCAAGGGCAAAAGGTGG - Intergenic
991732545 5:69603644-69603666 TCATTCACAGAAGCAGAAGGGGG - Intergenic
991808978 5:70458788-70458810 TCATTCACAGAAGCAGAAGGGGG - Intergenic
991862408 5:71024208-71024230 TCATTCACAGAAGCAGAAGGGGG + Intronic
992041673 5:72840577-72840599 ATATTCACAACAGCACTATGAGG - Intronic
992205361 5:74425752-74425774 TTATTCACAACAACCAAAGGTGG - Intergenic
992253441 5:74898266-74898288 TTATTCAAAACAGCAGGATGGGG - Intergenic
992271796 5:75072004-75072026 GGATTCACAACAGGATAATGTGG - Intronic
992291193 5:75281828-75281850 TCATTCACAATAGCAAAAGGTGG - Intergenic
992544306 5:77795532-77795554 CTATTCACAATACCAAAAGGGGG - Intronic
995062364 5:107824634-107824656 TAATTCACAGCACCATAGGGAGG + Intergenic
996179655 5:120403549-120403571 TTATTCAAAATAGCAAAAAGTGG + Intergenic
997682784 5:135767855-135767877 TTATAAACAACATCACAAGGGGG - Intergenic
998512683 5:142726519-142726541 TTATTCATAACAGCCCAAAGTGG - Intergenic
998609697 5:143674546-143674568 TTATTCACAACAGCCTTGGGGGG - Intergenic
999799613 5:155020374-155020396 TTATTCATAATAGCATAAAATGG - Intergenic
999928749 5:156407910-156407932 TTAAGGACAACACCATAAGGTGG - Intronic
1000551610 5:162672868-162672890 TTATTCACAACTGTTTAATGTGG + Intergenic
1000768841 5:165325639-165325661 TTATTCACAATAGCCAAAAGTGG + Intergenic
1001408220 5:171491797-171491819 TTATTCACAATAGCCAAAAGGGG + Intergenic
1001472520 5:172024650-172024672 TTATTCACAATAGCCAAAAGGGG - Intergenic
1001671276 5:173476134-173476156 TTATTCACAATGGCAAAGGGAGG + Intergenic
1002852549 6:1009531-1009553 TTATTCACAATAGCCAAAGGTGG - Intergenic
1002909030 6:1474143-1474165 TTATTCACAATAGGAAAGGGTGG - Intergenic
1003010740 6:2424948-2424970 TTGTTCACAATAGCAAAAGGTGG - Intergenic
1003338701 6:5199123-5199145 TCATTCACAAGAGCAAAAAGTGG + Intronic
1003664239 6:8094886-8094908 TTATTAAGAAAATCATAAGGCGG - Intronic
1003846037 6:10174267-10174289 TTATTCTCAAGAGCTGAAGGAGG + Intronic
1004030483 6:11863698-11863720 TTATTCACAATAGCCAAAGTTGG - Intergenic
1005443310 6:25894968-25894990 TTATTCTCAACAGAAAAAGGTGG + Intergenic
1005634554 6:27740900-27740922 ATATTTAAAAGAGCATAAGGAGG + Intergenic
1005804007 6:29456679-29456701 TGATTCACAACAGCAAAAACTGG + Intronic
1006351350 6:33523509-33523531 TTATTCACAACAGTCAAAAGAGG - Intergenic
1007843640 6:44736576-44736598 TTATTCACACTAGCCAAAGGTGG + Intergenic
1008787077 6:55181600-55181622 TTCTTCACAACAACATTATGAGG + Intronic
1009574249 6:65431379-65431401 ATCTTCAGAACAGAATAAGGAGG - Intronic
1010162417 6:72872334-72872356 TTTGTCATAAGAGCATAAGGAGG + Intronic
1010432311 6:75792367-75792389 TTATTCTCAAGAATATAAGGTGG + Intronic
1010946926 6:81985844-81985866 TTATTTACAAAAGAATAAAGAGG - Intergenic
1011738875 6:90339442-90339464 GTATTCATAACAAAATAAGGAGG - Intergenic
1011769933 6:90664270-90664292 TGAGTCACAACAGCATAATATGG - Intergenic
1012378441 6:98590417-98590439 TTATTTACAACAAAATAAAGTGG + Intergenic
1012530257 6:100227057-100227079 TTATTCACAATAGCCAAAAGTGG - Intergenic
1012773918 6:103479477-103479499 TTATTAACAATATCAAAAGGGGG - Intergenic
1013765301 6:113567080-113567102 TAATTCACAAAAGCTTAGGGTGG - Intergenic
1014164267 6:118205710-118205732 TTATTCATAATAGCCAAAGGTGG + Intronic
1015095163 6:129407545-129407567 ATATTCTTAACAGAATAAGGAGG + Intronic
1016533850 6:145089597-145089619 TTATTCACTAAGGCAGAAGGTGG + Intergenic
1017115766 6:150975136-150975158 TTATTCATAAGAGCCAAAGGTGG - Intronic
1017138610 6:151170167-151170189 TCATTCACAATAGCCAAAGGTGG - Intergenic
1017663268 6:156694578-156694600 TTATTCACAATAGCCAAAAGGGG + Intergenic
1017962010 6:159231791-159231813 GTATTTAAAACAGCATATGGAGG - Intronic
1018781143 6:167066761-167066783 TTATTCATAATAGCCAAAGGTGG + Intergenic
1019040915 6:169104500-169104522 TTATTCACAACAGCCAAATGAGG + Intergenic
1020027366 7:4908543-4908565 ATAATCACAACAGCAAAAGGTGG + Intronic
1020574550 7:9909575-9909597 CTATTCACAATAGCAAAAAGTGG - Intergenic
1020932082 7:14409853-14409875 TTATTAAGAAAATCATAAGGAGG - Intronic
1020960978 7:14801050-14801072 TTATTCATAACAAAGTAAGGAGG - Intronic
1021028900 7:15704372-15704394 ATATTCATAACAAAATAAGGAGG - Intergenic
1021140634 7:17020270-17020292 TTATTCACAATAGCAAGATGTGG + Intergenic
1021859569 7:24893191-24893213 TTATTCACAATAGTCAAAGGTGG + Intronic
1022797151 7:33741324-33741346 TTATTCACAAAATCCAAAGGCGG - Intergenic
1023117228 7:36874419-36874441 TTATTCTCAACAACCTAAAGAGG - Intronic
1023288105 7:38640359-38640381 TTATTCACAATACCCAAAGGTGG + Intergenic
1023667057 7:42534525-42534547 TTATTCAGAACAGCAAAACATGG + Intergenic
1023928104 7:44685541-44685563 TTATTCATAACAGGAAAATGTGG - Intronic
1026353434 7:69537086-69537108 TTATTCAAAGCAGCAGCAGGAGG - Intergenic
1028576748 7:92360518-92360540 TTATTCACAACAGCTAAAAGGGG - Intronic
1030035152 7:105402557-105402579 TTATTCATAATAGCTTAAGTTGG - Intergenic
1030063956 7:105644840-105644862 TTATTCACAATAGCCAAAGGTGG + Intronic
1030913256 7:115279280-115279302 TGATTCAAACCAGCAAAAGGTGG + Intergenic
1031017200 7:116587815-116587837 TTATTCACAACAGCCAGAAGGGG - Intergenic
1031945375 7:127834119-127834141 TTATTTACAACAGCCAAAGGTGG - Intronic
1033862002 7:145640015-145640037 TTATTTTTAACAGAATAAGGGGG - Intergenic
1034261153 7:149756606-149756628 TGATTCACAATACCATAAGGTGG + Intergenic
1034805922 7:154089141-154089163 TGACTCACAACAGCATAACTTGG + Intronic
1034829528 7:154297365-154297387 TTATTCACAAAATAAGAAGGGGG + Intronic
1035301461 7:157900320-157900342 TTATTTACAACAGCAGACAGTGG + Intronic
1036552377 8:9826739-9826761 TTATTTACAAAAGCATGCGGAGG - Intergenic
1037322907 8:17660457-17660479 TTATTCACAGTAGCCAAAGGTGG - Intronic
1037698325 8:21247961-21247983 TTATTCACAAAAGCCAAAGGTGG + Intergenic
1038602596 8:28961626-28961648 TTATTCACAAAAGCCAAATGTGG - Intronic
1038637524 8:29299797-29299819 TTATGAACAATAGCACAAGGTGG - Intergenic
1039541962 8:38380686-38380708 TTATTCATAACCGCCAAAGGAGG - Intronic
1040071330 8:43191171-43191193 TTGTTCACAACAGCAAAAAAGGG - Intronic
1041403995 8:57476514-57476536 TTATTTACAACAGCATTCGAAGG - Intergenic
1041835797 8:62213619-62213641 TTATTAAGAAAATCATAAGGAGG + Intergenic
1041835987 8:62215913-62215935 TTACTCACAACTGCTTCAGGTGG + Intergenic
1042469600 8:69169419-69169441 TTATTCACAATAGCCAAAGGTGG - Intergenic
1043349163 8:79339499-79339521 TTATTCACAAAAACAGATGGTGG - Intergenic
1043418559 8:80076223-80076245 CTATTCACAATAGCAAAGGGTGG + Intronic
1043860213 8:85307696-85307718 TTATTCACAATAGCCAAAAGGGG - Intergenic
1043910178 8:85854936-85854958 TTATTTACAAAAACATATGGTGG - Intergenic
1044433650 8:92136824-92136846 TTACTCAGAACAGCATAGGCTGG - Intergenic
1045751337 8:105487631-105487653 TTATTTACAAAAGCAGATGGAGG + Intronic
1045765316 8:105660975-105660997 TAATTCACAACACCAGCAGGTGG + Intronic
1045927694 8:107590807-107590829 TTATGAACAACATCACAAGGGGG - Intergenic
1047803736 8:128336900-128336922 TTATTCACAGTAGCAAAAGGTGG - Intergenic
1049752760 8:144293105-144293127 TCATTCCTAACAGCATAAAGAGG - Intronic
1050638814 9:7643027-7643049 TTATTCACAACAGCAAAGACAGG - Intergenic
1051330124 9:16016040-16016062 CTATTCACAATAGCCAAAGGTGG - Intronic
1052355179 9:27496807-27496829 TTAATAACAACAGCATAATGAGG - Intronic
1052562274 9:30100626-30100648 TTATTCACAACAGCCCAAACAGG + Intergenic
1052676356 9:31630310-31630332 TTATAGATCACAGCATAAGGTGG - Intergenic
1052759469 9:32575278-32575300 TTATTAAGAAAATCATAAGGAGG + Intergenic
1053585622 9:39455553-39455575 TTCCTAACAACAGCATATGGGGG - Intergenic
1053639502 9:40057131-40057153 TTATTCACAACAGCTTAAATTGG + Intergenic
1053766579 9:41407983-41408005 TTATTCACAACAGCTTAAATTGG - Intergenic
1054320304 9:63653790-63653812 TTATTCACAACAGCTTAAATTGG + Intergenic
1054353910 9:64043753-64043775 TTATTAAGAACAGTATAATGGGG + Intergenic
1054545246 9:66319488-66319510 TTATTCACAACAGCTTAAATTGG - Intergenic
1054580689 9:66909672-66909694 TTCCTAACAACAGCATATGGGGG + Intronic
1055183527 9:73420291-73420313 ATATTCACAACAGAATAGAGTGG + Intergenic
1055392199 9:75834876-75834898 TTATTTACAAAAGCAAAAAGTGG - Intergenic
1055576784 9:77668255-77668277 TTATTCACAATAGCCAAAAGAGG + Intergenic
1056240789 9:84644650-84644672 ATATTCATAACAAAATAAGGAGG + Intergenic
1057500352 9:95592780-95592802 CTCTTCACAACAGCAAAAAGGGG + Intergenic
1057864580 9:98668970-98668992 TTATTCACAATAGCTGAAAGGGG - Intronic
1058359594 9:104128431-104128453 TTATTTACAAGAGTAAAAGGAGG + Intronic
1058519039 9:105801420-105801442 TTAGGAACAACATCATAAGGGGG + Intergenic
1059398407 9:114053415-114053437 ATATTCTCAGCAGCCTAAGGTGG + Exonic
1059631890 9:116133907-116133929 TTATTCACAACAGCAAAATGTGG + Intergenic
1059788377 9:117612170-117612192 TTATTGACAAAACCATAAGTGGG + Intergenic
1061599006 9:131653847-131653869 TTATTCATAATAGCCAAAGGTGG + Intronic
1202787374 9_KI270719v1_random:40827-40849 TTATTCACAACAGCTTAAATTGG + Intergenic
1203356550 Un_KI270442v1:154240-154262 TTATTCACAATAGCAAAACTTGG + Intergenic
1185948683 X:4406228-4406250 TTATTAAGAAAATCATAAGGAGG + Intergenic
1186703996 X:12122972-12122994 TTCTGCACAACTGTATAAGGAGG + Intergenic
1187413096 X:19068186-19068208 TTATTCACAACAGCCAAAAGGGG + Intronic
1187530887 X:20095681-20095703 TTATTCACAATAGCCAAAAGGGG + Intronic
1189076084 X:37916206-37916228 TCCCACACAACAGCATAAGGTGG + Intronic
1189550734 X:42089889-42089911 TTATTTACAATAGCAAAAAGGGG - Intergenic
1189747295 X:44182365-44182387 CTATTCACAACAGCCAAAGGTGG - Intronic
1189898370 X:45680289-45680311 TTATTCACAATAGCTAAAAGTGG + Intergenic
1189963950 X:46352749-46352771 ATATTCACAACAAAATAAGGTGG + Intergenic
1191721874 X:64237637-64237659 TTATTAACAAAAGCCAAAGGTGG - Intergenic
1192276720 X:69639189-69639211 TTATTCACAATACCCCAAGGTGG - Intronic
1192896560 X:75448419-75448441 GTATTCATAACAACATAAGAAGG - Intronic
1192928346 X:75779625-75779647 TTATTGAAAACAGCATTAAGTGG + Intergenic
1195518503 X:105804600-105804622 TTATACACCAAAGAATAAGGTGG + Intergenic
1195874088 X:109520035-109520057 CTATTCACAATAGCTAAAGGTGG + Intergenic
1196472306 X:116042315-116042337 CTATTCACAATAGCAAAAAGTGG + Intergenic
1197081269 X:122419933-122419955 TTATTCACAATAGCCAAAGGTGG - Intergenic
1197418988 X:126213875-126213897 TTATTCACAATAGCAAAAAATGG + Intergenic
1199481824 X:148306099-148306121 TTATTAAGAAAATCATAAGGAGG - Intergenic
1200096197 X:153664619-153664641 TTATTCACAACAGCTAAAAGTGG + Intergenic
1200423883 Y:3001654-3001676 GTATGCACAACTGCAAAAGGTGG + Intergenic
1201343019 Y:12954240-12954262 CTATCTACAACTGCATAAGGTGG + Intergenic