ID: 1170586112

View in Genome Browser
Species Human (GRCh38)
Location 20:17735388-17735410
Sequence ATGTGCTTGTCAAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170586108_1170586112 7 Left 1170586108 20:17735358-17735380 CCCGCATTTTAACAAGCTCCCAC 0: 1
1: 1
2: 15
3: 65
4: 285
Right 1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 199
1170586109_1170586112 6 Left 1170586109 20:17735359-17735381 CCGCATTTTAACAAGCTCCCACA 0: 1
1: 0
2: 1
3: 22
4: 266
Right 1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 199
1170586106_1170586112 29 Left 1170586106 20:17735336-17735358 CCCTGGACTTAGACTTTCAGAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 199
1170586107_1170586112 28 Left 1170586107 20:17735337-17735359 CCTGGACTTAGACTTTCAGAACC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170586112 Original CRISPR ATGTGCTTGTCAAAGTTTGA AGG Intronic
904071506 1:27801855-27801877 ATGTTCTTTTCCAAGTTTGTGGG + Intronic
906462129 1:46042616-46042638 ATGTGCTTCCCCAAGTTTAAAGG - Exonic
907081179 1:51623834-51623856 ATTTGCTTTTAAATGTTTGATGG - Intronic
908662989 1:66457454-66457476 ATGTGTTTGTCAAAATTTATAGG - Intergenic
912577875 1:110691986-110692008 ATGTGCAGGTCAAAGTCTGGAGG + Intergenic
916750315 1:167717646-167717668 ATGTGTTTGTCAACGTGTTAGGG - Intergenic
916771372 1:167912300-167912322 ATTTGCTTATCAAAGGTTGCCGG - Intronic
917221215 1:172730761-172730783 ATGTACTTGTGTAAGTTTCAGGG - Intergenic
917955273 1:180090147-180090169 ACTTGCATGTAAAAGTTTGAAGG + Intronic
919324642 1:196091123-196091145 ATGAGCTTGTCAAAGTCAGCTGG - Intergenic
920639706 1:207740684-207740706 ATTTGCTTGTTAAAGGTTGCTGG - Intergenic
920876117 1:209837507-209837529 TTGTGGTTGTCAAAGCTGGATGG + Intronic
921233729 1:213101434-213101456 ATCTGCTTGTCAAAGTTTAGTGG + Intronic
924218433 1:241848688-241848710 ATGTACTTGTCAACATTTAAAGG - Intronic
924900153 1:248388931-248388953 ATTGGCTTGTCAAAGATTTAGGG + Intergenic
1064091238 10:12387273-12387295 ATGTGAGTGTCAAAGCGTGAAGG - Intronic
1064873419 10:19965258-19965280 ATGTGATTGACAGAGTTTCAAGG + Intronic
1065675340 10:28167654-28167676 ATATTCTTGTAAAAGTTTGCTGG + Intronic
1066295364 10:34049345-34049367 ATTTGCTTCTCAGAGTTGGACGG - Intergenic
1066949892 10:42106692-42106714 CTTTGCTCGTCAAAGTTTTAGGG - Intergenic
1068260774 10:54578219-54578241 TTGTGCCTTTCAAAGTTTGAGGG + Intronic
1068522507 10:58093373-58093395 ATTTGCTTATCAAAGCTTGCTGG + Intergenic
1068645518 10:59462478-59462500 ATGTGCATGGCAGAGTCTGAAGG + Intergenic
1070660796 10:78303918-78303940 TTGTTCTTGCCAAAGGTTGAGGG + Intergenic
1071767002 10:88678245-88678267 AAGTGCTTGTCAAATTCTAATGG - Intronic
1074061723 10:109972518-109972540 AAGTGCTTGTCAAATATTAATGG - Intergenic
1074833566 10:117267401-117267423 TTGTTCTTGTCAAAACTTGAGGG + Intronic
1075349489 10:121710927-121710949 AAGTGATTTTCAAAGTTGGAGGG + Intergenic
1080293452 11:30698104-30698126 ATGTGTTTCTCAAAGGTTTATGG + Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1085989220 11:81820749-81820771 ATGTGTTTCTCAATGTTAGAAGG - Intergenic
1086014618 11:82152076-82152098 ATGTGTTTTTCAAACATTGAGGG - Intergenic
1087916142 11:103813139-103813161 ATTTGCTTGTCAAAGTTTCCTGG - Intergenic
1088544614 11:110947004-110947026 ATGTGCCAGGCAAAGTGTGAGGG - Intergenic
1088607492 11:111545447-111545469 ATTTGCTTGCCCAATTTTGATGG - Intronic
1091878096 12:3953801-3953823 ATGTGCTTGACAAAAGTTTAGGG - Intergenic
1092828212 12:12417605-12417627 GTTTGCTTGACAAATTTTGATGG + Intronic
1095466195 12:42490323-42490345 CTGAGCCGGTCAAAGTTTGAGGG + Intronic
1097419804 12:59362082-59362104 ATGTGTTGGTTATAGTTTGATGG - Intergenic
1098604668 12:72375410-72375432 ATCTGCTTGTCAAGATTTAATGG - Intronic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1100170395 12:91969276-91969298 ATGTGCTTGGCAAAGGAAGAAGG + Intergenic
1101480316 12:105090402-105090424 ATTTGCATATCAAAGTTTGCCGG - Intergenic
1102392210 12:112558286-112558308 ACGTGCTTGGCATGGTTTGAAGG - Intergenic
1102817757 12:115881733-115881755 ATCTGCTTGTTAAAGTAGGACGG - Intergenic
1103238393 12:119393880-119393902 AGGTGCTGGTTAAAGTCTGATGG - Intronic
1104337588 12:127914310-127914332 ATGTGCTTGCCAAGTTGTGAGGG + Intergenic
1105685153 13:22773583-22773605 ATGTTCCTTTCAGAGTTTGAGGG - Intergenic
1106202935 13:27557865-27557887 TTGTGTTTGTCTAATTTTGAAGG - Intronic
1106749061 13:32739095-32739117 ATGTTCTTCTAAAACTTTGAAGG + Intronic
1108757663 13:53523198-53523220 AGGTCCTTCTCAAAGTTTGGTGG - Intergenic
1108852216 13:54744997-54745019 ATGTGCTTGTCAAAGCTGTATGG - Intergenic
1109135710 13:58647805-58647827 ATGTGTTTGTTTATGTTTGAAGG - Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1110488232 13:76071082-76071104 ATGTGATTGCCAATGTTGGAGGG - Intergenic
1111769038 13:92573148-92573170 ACTTGCTAGTGAAAGTTTGAGGG - Intronic
1112070798 13:95847469-95847491 AAGTGGTTGTCAGAGTTTGGTGG - Intronic
1112952965 13:105024238-105024260 ATGTGCTTTTCTAATTGTGAGGG + Intergenic
1113418048 13:110146421-110146443 ATTTTCTTCTCAAAGTTTTATGG - Intergenic
1114349195 14:21831833-21831855 GGGTGCTTCTCAAACTTTGAAGG - Intergenic
1115114292 14:29861138-29861160 AGGTGCTAGTCATAGTTTGTTGG - Intronic
1115844563 14:37513381-37513403 ATGTACTTGTCAAACATTGTAGG - Intronic
1118153106 14:63210933-63210955 ATGTGGTTTTCCAAATTTGATGG - Intronic
1120267310 14:82267516-82267538 ATGTGCTTGTCAGTGTTTGAGGG + Intergenic
1121863554 14:97341409-97341431 ATGTGGTAGTCCAACTTTGAGGG - Intergenic
1124189221 15:27557657-27557679 ATGTTCTTGTCATATTATGATGG + Intergenic
1126968555 15:54083764-54083786 CTGTGCTTGTGAAAGTCTGAGGG + Intronic
1130018788 15:80209558-80209580 GTGTACTTGTCAAAGCGTGAAGG + Intergenic
1133310711 16:4844822-4844844 ATGTGATTGTTATAGTTAGAAGG + Intronic
1133984635 16:10659116-10659138 ATGTGGTTGTCACAGCTTGCGGG - Intronic
1134253430 16:12591437-12591459 ATGTGCTTTGCAAAGATGGATGG + Intergenic
1135262650 16:20994657-20994679 AAGTGGTTGTCAAAGTCTGGAGG - Intronic
1137532320 16:49286924-49286946 ATGTGCATGTCACTGTTTTAAGG + Intergenic
1137778489 16:51076715-51076737 TTGGGCTTGTCAAAAATTGATGG + Intergenic
1138363536 16:56452917-56452939 ATGTGCTACCCAAAGTTTGAGGG + Intronic
1138509368 16:57499232-57499254 ATGTGCTTGTCTTATTTTCAAGG - Intergenic
1138851062 16:60630376-60630398 ATGTGTTTATAAAAGTTTTATGG - Intergenic
1140680116 16:77376439-77376461 ATGTGGCTGCCAAAGGTTGATGG + Intronic
1141027307 16:80560689-80560711 TAGTGCTTCTCAAAGTTTAATGG - Intergenic
1143420667 17:6789202-6789224 ATGTGAATGGCCAAGTTTGATGG + Intronic
1143426508 17:6843784-6843806 TTGTGCCTGACAAAGTTTGTGGG + Intergenic
1143745591 17:8991843-8991865 ATGTGCTTGTGAGGGTTTGGAGG - Intergenic
1144593601 17:16546208-16546230 ATTTGCATATCAAAGGTTGATGG - Intergenic
1144818114 17:18051020-18051042 ATTTAATTCTCAAAGTTTGAGGG + Intronic
1145099275 17:20060283-20060305 ATGTCACTTTCAAAGTTTGATGG - Intronic
1147668174 17:42161802-42161824 ATGTGCTTCCCAGAGTTTTAAGG - Intronic
1148835097 17:50461746-50461768 CTCTGCTTGTCAGAGTCTGACGG + Intronic
1149260118 17:54871193-54871215 TTATGCAAGTCAAAGTTTGAGGG + Intergenic
1151124879 17:71833641-71833663 AAGTTTTTGTTAAAGTTTGAAGG - Intergenic
1155771914 18:29712234-29712256 ATTTGCATGTCAAAGGTTGCCGG + Intergenic
1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG + Intronic
1157054166 18:44205458-44205480 ATGTGATTGTAAACATTTGATGG - Intergenic
1159116540 18:64120049-64120071 AAGTGCTTCTCAAAAATTGATGG - Intergenic
1159345564 18:67199112-67199134 ATATGTTTTTCAAAGTCTGAAGG - Intergenic
925496728 2:4458910-4458932 AGTTGCTTCTCAAAGTTTCAGGG + Intergenic
925617305 2:5755875-5755897 ATGAACTTGTCAAAGTTATAAGG + Intergenic
933431386 2:82184217-82184239 ATGCCCATGTTAAAGTTTGATGG + Intergenic
938218771 2:129547075-129547097 ATGTGCGTGTCAAAATTTTATGG - Intergenic
939294395 2:140240811-140240833 ATGTGCATGTGAAAGTATCAAGG + Intronic
940047628 2:149426414-149426436 AAGTGCTTGTTAATGGTTGAAGG + Intronic
940135491 2:150431143-150431165 ATGTGCTTTCAAATGTTTGATGG + Intergenic
940761868 2:157747602-157747624 ATGTGAATGTTAAAATTTGAAGG + Intronic
942156633 2:173135546-173135568 ATGTGATTTTCAAACTGTGATGG + Intronic
942384140 2:175423522-175423544 AAGTACTTGGCAAAGTTTGGAGG - Intergenic
946037431 2:216755179-216755201 ATGAGCTGGACAAAGGTTGAAGG - Intergenic
1168806131 20:673337-673359 CTGAGCTTGTCAAAGTTGGAAGG + Intronic
1168966975 20:1904652-1904674 ATGTGATTGTCATCGTTTTATGG + Intronic
1169725451 20:8724289-8724311 CAGTGCTTCTCAAACTTTGATGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1171818465 20:29810268-29810290 GTTTTCTTGTAAAAGTTTGATGG + Intergenic
1172115693 20:32572264-32572286 ATGTGATTGTCCAAATTTGGTGG - Intronic
1173770163 20:45649411-45649433 ATGAGATGGTCAAAGGTTGATGG + Intronic
1177594088 21:23212965-23212987 ATGTGCTTGCAAAAGCTTCATGG - Intergenic
1177600969 21:23313332-23313354 ACGTGCTTTGCAATGTTTGATGG + Intergenic
1178325453 21:31641831-31641853 ATGTGCATATCAAAGGTTGCTGG + Intergenic
1180333153 22:11551011-11551033 GTTTTCTTGTAAAAGTTTGATGG - Intergenic
1180597265 22:16986304-16986326 ACGTGCATGTGAAAGTATGAAGG + Intronic
949358680 3:3208718-3208740 CTGTGGTTGTCAGGGTTTGAGGG + Intergenic
950108562 3:10403905-10403927 ATGTGTTTGCCAAAGATTCATGG + Intronic
951254829 3:20436593-20436615 ATGTATTTGAAAAAGTTTGAGGG + Intergenic
952291249 3:32018228-32018250 ATGTGATTGTTAAACTATGATGG + Intronic
953095316 3:39769150-39769172 ATGTCCTTGTCAAAGGTCAAGGG + Intergenic
955683193 3:61524315-61524337 ATGTGCATGTCAAATTTGGCAGG + Intergenic
955684674 3:61538010-61538032 ATGTGCTTAGGGAAGTTTGAAGG + Intergenic
956501350 3:69888932-69888954 AGGTGCTTGTCAAAGTGTATTGG + Intronic
957005354 3:74939261-74939283 ATGTGCTTGTAAAAGTTACTAGG + Intergenic
958488036 3:94736856-94736878 TTGTTCTTGTAAAATTTTGAAGG + Intergenic
960642407 3:119839064-119839086 TTGTACTAGTCAAAGTTTGTTGG + Intronic
962200281 3:133395537-133395559 CTTTCCTTGTCAAAGTCTGAGGG - Intronic
964195741 3:154062540-154062562 ATTTGCATATCAAAGTTTGCCGG - Intergenic
964374865 3:156040006-156040028 ATATGATTGTCAAAGGATGATGG + Intronic
964701966 3:159577975-159577997 CAGTGCTTCTCAAAGTTTAATGG + Intronic
964862769 3:161220741-161220763 CTGTGCTGCTCCAAGTTTGAGGG + Intronic
965240911 3:166196125-166196147 ATTTGCTTGTTGAAATTTGATGG + Intergenic
965367583 3:167819708-167819730 ATGTGCTTTTCAAAGCTTGAAGG + Intronic
967695180 3:192522551-192522573 ATTGGCTTTTTAAAGTTTGAAGG - Intronic
969036708 4:4259744-4259766 ATATGTTTGTCAGAGTTTAAAGG - Intergenic
969916224 4:10494010-10494032 ATGTTCTTGGCAAAGCTAGAAGG - Intronic
970012382 4:11473351-11473373 ATATGATTGTCACAGTTTTATGG - Intergenic
971062223 4:22985193-22985215 ATTTCCTAGCCAAAGTTTGAGGG + Intergenic
972443885 4:39124703-39124725 ATTTTCTTCTCAAAGTTTTATGG - Intronic
974601931 4:64094561-64094583 ATGTGATATTCTAAGTTTGAAGG - Intergenic
975058366 4:69964500-69964522 ATGTTCTTTTCAATATTTGAAGG + Intergenic
977419522 4:96780506-96780528 ATGTTCATGACACAGTTTGATGG + Intergenic
977538880 4:98290628-98290650 AAAGGCTTGGCAAAGTTTGAAGG + Intronic
978092711 4:104737430-104737452 ATTCCCTTGTCAAAGTATGAGGG - Intergenic
978161893 4:105558500-105558522 AGGTGTGTGTCATAGTTTGAAGG + Intronic
979033418 4:115680388-115680410 GTGTGCTTGTCAAGGTGTTATGG + Intergenic
979408852 4:120349106-120349128 TTATTCTTGTGAAAGTTTGACGG - Intergenic
982694786 4:158587192-158587214 ATGGGCTTGTGAAGGTTTGAAGG - Intronic
982919168 4:161252223-161252245 ATTTGCGTATCAAAGTTTGCCGG + Intergenic
983753808 4:171308560-171308582 AAGTGCTTGTCAAGGGTTTAGGG - Intergenic
984899163 4:184569475-184569497 TTGTGCTTTTCACAGATTGAAGG - Intergenic
986822598 5:11483772-11483794 ATGTGCTCAACAAAGTTTAAAGG + Intronic
987243593 5:16026300-16026322 ATATTCTAGTCAAAGTCTGAAGG + Intergenic
992111150 5:73495436-73495458 TGGTGCTTTACAAAGTTTGAAGG - Intergenic
993785187 5:92123676-92123698 ATGTGTTTCACAAAGTTTGCTGG + Intergenic
995973248 5:117999102-117999124 ATGTGTTTGTCAAACGTTCATGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1000180143 5:158801127-158801149 ATGTTATTGTCATAGTTTGAAGG - Intronic
1001046031 5:168372456-168372478 ATGTGCCTGGCAAAGTCTGAAGG + Intronic
1003858637 6:10301250-10301272 ATTTGCCTGTGAAAGTTAGAAGG - Intergenic
1004591883 6:17059768-17059790 ATTTGCTTCTCAAAGATAGAGGG - Intergenic
1004645471 6:17555901-17555923 ATGTGCATGTTAAAGTTTAGTGG + Intronic
1005417400 6:25614919-25614941 AGGAGCTGGTCAAATTTTGATGG + Intronic
1006986840 6:38181109-38181131 ATTTGCTTGACAAATTTTCAAGG + Intronic
1011407606 6:87031969-87031991 AAGTGCTTGTCAAAGTGTCTGGG - Intergenic
1012955859 6:105569278-105569300 ATTTGCTGGTCAAACTTTGAGGG + Intergenic
1014287014 6:119511320-119511342 ATGTACTTGTCACAAATTGAAGG + Intergenic
1015513905 6:134066169-134066191 ATCTGCTTGTCCAAGTTCGAGGG + Intergenic
1016562494 6:145412788-145412810 TTGTGCTTGTCATAGTTGTATGG + Intergenic
1021208981 7:17821202-17821224 TTGTGCTTTTCAAAGTTTTTTGG - Intronic
1021277144 7:18665876-18665898 ATGTCCTTTTGAAAGTTTCAGGG + Intronic
1022376283 7:29814518-29814540 ATGTGCTTGTCGAAGGCTGGGGG + Intronic
1022976748 7:35565610-35565632 AAGTGGTTGGCAAAGTTTTATGG + Intergenic
1023128879 7:36982912-36982934 CTGTGTTCGTCAGAGTTTGAGGG - Intronic
1023517549 7:41017219-41017241 ATGAGAATGTCAAAGTTTTAGGG - Intergenic
1023896841 7:44441026-44441048 ATTTGCTTTTCAAAGTTGGTGGG - Intronic
1024429651 7:49272273-49272295 ATGTGTTTGTTAAATTTTCAGGG - Intergenic
1024719855 7:52123656-52123678 ATGTGCTTGTATTAGTTTGGCGG + Intergenic
1026366376 7:69652664-69652686 ATGTGTTTGTAAAACTTTGCAGG - Intronic
1028589207 7:92478760-92478782 ATTTGCATATCAAAGTTTGCTGG - Intergenic
1029331224 7:99857490-99857512 ATATGGTTGTCAAACTTTGATGG - Intronic
1036038994 8:5053266-5053288 CTTTGCTTGTCAAAGTGTAATGG - Intergenic
1038416859 8:27403202-27403224 ATGTGCTTGGCAAATTTGAAAGG - Intronic
1042100367 8:65269929-65269951 ATGTCCTTGTCAGAGTTAGAAGG - Intergenic
1042335232 8:67623046-67623068 ATTTTCTTGGCAAAGGTTGAAGG - Intronic
1043717352 8:83504577-83504599 ATGTATTTGTAAAATTTTGAGGG + Intergenic
1044071183 8:87762131-87762153 AACTGCTTGTCAAAGTTTTGAGG + Intergenic
1044565292 8:93656012-93656034 AAATGCTTGTCAAAACTTGATGG + Intergenic
1045139440 8:99264133-99264155 ATGTTTATGTCAGAGTTTGAGGG - Intronic
1046391962 8:113586256-113586278 ATGTGCTTTTCAGATTTTAAAGG - Intergenic
1048567376 8:135616052-135616074 ATTTACTTAACAAAGTTTGAAGG + Intronic
1050739227 9:8801424-8801446 CTGTGCTTGGCCAGGTTTGATGG - Intronic
1052493450 9:29195040-29195062 TAGTGCTTGACAAAGTTTGGGGG - Intergenic
1052692105 9:31828018-31828040 ATGTGCTTGTCAAAGTGCTTTGG + Intergenic
1055738304 9:79357212-79357234 ATTTCCTTGTCAAATTGTGAGGG + Intergenic
1056140385 9:83672793-83672815 GTGTGATTTTCACAGTTTGAAGG - Intronic
1057944488 9:99313192-99313214 ATGTGCATTTTAAAATTTGATGG + Intergenic
1058489420 9:105480678-105480700 AGATGATTGTGAAAGTTTGAAGG + Intronic
1058866309 9:109165346-109165368 ATGTCCTTGTTCAAGATTGAGGG - Intronic
1059318082 9:113444343-113444365 TTGTGATTGTCTAAATTTGAGGG - Intergenic
1059739252 9:117133709-117133731 AAGAGGTTGTCAAAGTTTGGAGG + Intronic
1203370120 Un_KI270442v1:295545-295567 GTTTTCTTGTAAAAGTTTGATGG + Intergenic
1187887532 X:23903451-23903473 CAGTGCTTGTCAAACTTTAATGG - Intronic
1189074196 X:37898422-37898444 TTGTCCTTGTCAAGGTTCGATGG + Intronic
1190961785 X:55257458-55257480 ATGTGCCTCACAAGGTTTGAAGG + Intronic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1197159558 X:123308225-123308247 CAGTGCTTCTCAAATTTTGATGG + Intronic
1197227573 X:123969198-123969220 ATATGCTTATTAAAGTTTGTGGG + Intronic
1197315157 X:124956961-124956983 ATGCACTTCTCAAATTTTGAGGG + Intronic
1197640572 X:128963151-128963173 ATGTTCTTAACAAAATTTGATGG + Intergenic
1198501081 X:137247201-137247223 ATCTGCTTTTCAAAGTTTTCAGG + Intergenic
1198805686 X:140491876-140491898 GTTTGCTGGCCAAAGTTTGAGGG + Intergenic
1199338716 X:146650282-146650304 ATGTCAATGTCAAAATTTGAGGG - Intergenic
1200362364 X:155622087-155622109 CTGTGCTTGTCAGAGCATGATGG + Intronic
1201068180 Y:10119545-10119567 GTTTTCTTGTAAAAGTTTGATGG - Intergenic