ID: 1170589667

View in Genome Browser
Species Human (GRCh38)
Location 20:17762357-17762379
Sequence GGCCTTGGTGCAGCATTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170589667_1170589677 17 Left 1170589667 20:17762357-17762379 CCCTTCAATGCTGCACCAAGGCC No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data
1170589667_1170589671 -2 Left 1170589667 20:17762357-17762379 CCCTTCAATGCTGCACCAAGGCC No data
Right 1170589671 20:17762378-17762400 CCTCTTGCCTTACCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170589667 Original CRISPR GGCCTTGGTGCAGCATTGAA GGG (reversed) Intergenic
No off target data available for this crispr