ID: 1170589669

View in Genome Browser
Species Human (GRCh38)
Location 20:17762372-17762394
Sequence CTGGGTAAGGCAAGAGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170589669_1170589677 2 Left 1170589669 20:17762372-17762394 CCAAGGCCTCTTGCCTTACCCAG No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data
1170589669_1170589684 30 Left 1170589669 20:17762372-17762394 CCAAGGCCTCTTGCCTTACCCAG No data
Right 1170589684 20:17762425-17762447 TACTCTGAATGCCTGGCATTTGG No data
1170589669_1170589682 23 Left 1170589669 20:17762372-17762394 CCAAGGCCTCTTGCCTTACCCAG No data
Right 1170589682 20:17762418-17762440 GGTTTCCTACTCTGAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170589669 Original CRISPR CTGGGTAAGGCAAGAGGCCT TGG (reversed) Intergenic
No off target data available for this crispr