ID: 1170589670

View in Genome Browser
Species Human (GRCh38)
Location 20:17762378-17762400
Sequence CCAGGGCTGGGTAAGGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170589670_1170589677 -4 Left 1170589670 20:17762378-17762400 CCTCTTGCCTTACCCAGCCCTGG No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data
1170589670_1170589684 24 Left 1170589670 20:17762378-17762400 CCTCTTGCCTTACCCAGCCCTGG No data
Right 1170589684 20:17762425-17762447 TACTCTGAATGCCTGGCATTTGG No data
1170589670_1170589682 17 Left 1170589670 20:17762378-17762400 CCTCTTGCCTTACCCAGCCCTGG No data
Right 1170589682 20:17762418-17762440 GGTTTCCTACTCTGAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170589670 Original CRISPR CCAGGGCTGGGTAAGGCAAG AGG (reversed) Intergenic
No off target data available for this crispr