ID: 1170589677

View in Genome Browser
Species Human (GRCh38)
Location 20:17762397-17762419
Sequence CTGGCTTCACCCTCCCATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170589670_1170589677 -4 Left 1170589670 20:17762378-17762400 CCTCTTGCCTTACCCAGCCCTGG No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data
1170589667_1170589677 17 Left 1170589667 20:17762357-17762379 CCCTTCAATGCTGCACCAAGGCC No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data
1170589664_1170589677 19 Left 1170589664 20:17762355-17762377 CCCCCTTCAATGCTGCACCAAGG No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data
1170589669_1170589677 2 Left 1170589669 20:17762372-17762394 CCAAGGCCTCTTGCCTTACCCAG No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data
1170589666_1170589677 18 Left 1170589666 20:17762356-17762378 CCCCTTCAATGCTGCACCAAGGC No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data
1170589668_1170589677 16 Left 1170589668 20:17762358-17762380 CCTTCAATGCTGCACCAAGGCCT No data
Right 1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170589677 Original CRISPR CTGGCTTCACCCTCCCATCA CGG Intergenic
No off target data available for this crispr