ID: 1170590208

View in Genome Browser
Species Human (GRCh38)
Location 20:17765810-17765832
Sequence GACCACCCAGCCCTGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170590208_1170590213 -1 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590213 20:17765832-17765854 CTGGGTCGAGTTAGGGTCCCAGG No data
1170590208_1170590211 -9 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590211 20:17765824-17765846 TGGGTGGTCTGGGTCGAGTTAGG No data
1170590208_1170590215 7 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590215 20:17765840-17765862 AGTTAGGGTCCCAGGGCTCCAGG No data
1170590208_1170590221 29 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590221 20:17765862-17765884 GCTGTGACCAGATGGAGCATGGG No data
1170590208_1170590212 -8 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590212 20:17765825-17765847 GGGTGGTCTGGGTCGAGTTAGGG No data
1170590208_1170590218 21 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590218 20:17765854-17765876 GGCTCCAGGCTGTGACCAGATGG No data
1170590208_1170590214 0 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590214 20:17765833-17765855 TGGGTCGAGTTAGGGTCCCAGGG No data
1170590208_1170590220 28 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170590208 Original CRISPR GACCACCCAGCCCTGCCCCC AGG (reversed) Intergenic
No off target data available for this crispr