ID: 1170590220

View in Genome Browser
Species Human (GRCh38)
Location 20:17765861-17765883
Sequence GGCTGTGACCAGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170590208_1170590220 28 Left 1170590208 20:17765810-17765832 CCTGGGGGCAGGGCTGGGTGGTC No data
Right 1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG No data
1170590207_1170590220 29 Left 1170590207 20:17765809-17765831 CCCTGGGGGCAGGGCTGGGTGGT No data
Right 1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170590220 Original CRISPR GGCTGTGACCAGATGGAGCA TGG Intergenic
No off target data available for this crispr