ID: 1170592772

View in Genome Browser
Species Human (GRCh38)
Location 20:17783521-17783543
Sequence TGAGATCTGGTGAGGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170592772_1170592777 3 Left 1170592772 20:17783521-17783543 CCTCCTGGCCTCACCAGATCTCA No data
Right 1170592777 20:17783547-17783569 CTCATCTGTTTTGTGTTTTGAGG No data
1170592772_1170592778 14 Left 1170592772 20:17783521-17783543 CCTCCTGGCCTCACCAGATCTCA No data
Right 1170592778 20:17783558-17783580 TGTGTTTTGAGGTTCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170592772 Original CRISPR TGAGATCTGGTGAGGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr