ID: 1170593289

View in Genome Browser
Species Human (GRCh38)
Location 20:17787279-17787301
Sequence CCTGCCCTGCAGCCTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170593289_1170593301 20 Left 1170593289 20:17787279-17787301 CCCTCCAAAGGCTGCAGGGCAGG No data
Right 1170593301 20:17787322-17787344 GGGTTAAATGTCACTTCCCAGGG No data
1170593289_1170593295 -1 Left 1170593289 20:17787279-17787301 CCCTCCAAAGGCTGCAGGGCAGG No data
Right 1170593295 20:17787301-17787323 GAGCATTGGTCTGGACCCCATGG No data
1170593289_1170593296 0 Left 1170593289 20:17787279-17787301 CCCTCCAAAGGCTGCAGGGCAGG No data
Right 1170593296 20:17787302-17787324 AGCATTGGTCTGGACCCCATGGG No data
1170593289_1170593294 -10 Left 1170593289 20:17787279-17787301 CCCTCCAAAGGCTGCAGGGCAGG No data
Right 1170593294 20:17787292-17787314 GCAGGGCAGGAGCATTGGTCTGG No data
1170593289_1170593300 19 Left 1170593289 20:17787279-17787301 CCCTCCAAAGGCTGCAGGGCAGG No data
Right 1170593300 20:17787321-17787343 TGGGTTAAATGTCACTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170593289 Original CRISPR CCTGCCCTGCAGCCTTTGGA GGG (reversed) Intergenic
No off target data available for this crispr