ID: 1170597072

View in Genome Browser
Species Human (GRCh38)
Location 20:17814108-17814130
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170597072 Original CRISPR GCTTATGTGACCGTGGAGGC TGG Intergenic