ID: 1170598237 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:17821474-17821496 |
Sequence | AGGTATACCAAAGAACATCG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1170598232_1170598237 | -3 | Left | 1170598232 | 20:17821454-17821476 | CCCAGAGGCAGGAAAACCCAAGG | No data | ||
Right | 1170598237 | 20:17821474-17821496 | AGGTATACCAAAGAACATCGAGG | No data | ||||
1170598234_1170598237 | -4 | Left | 1170598234 | 20:17821455-17821477 | CCAGAGGCAGGAAAACCCAAGGT | No data | ||
Right | 1170598237 | 20:17821474-17821496 | AGGTATACCAAAGAACATCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1170598237 | Original CRISPR | AGGTATACCAAAGAACATCG AGG | Intergenic | ||