ID: 1170598237

View in Genome Browser
Species Human (GRCh38)
Location 20:17821474-17821496
Sequence AGGTATACCAAAGAACATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170598232_1170598237 -3 Left 1170598232 20:17821454-17821476 CCCAGAGGCAGGAAAACCCAAGG No data
Right 1170598237 20:17821474-17821496 AGGTATACCAAAGAACATCGAGG No data
1170598234_1170598237 -4 Left 1170598234 20:17821455-17821477 CCAGAGGCAGGAAAACCCAAGGT No data
Right 1170598237 20:17821474-17821496 AGGTATACCAAAGAACATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170598237 Original CRISPR AGGTATACCAAAGAACATCG AGG Intergenic